LOCUS       NR_129265                 79 bp    RNA     linear   MAM 09-MAY-2023
DEFINITION  Eptesicus fuscus microRNA mir-375 (MIR375), microRNA.
ACCESSION   NR_129265
VERSION     NR_129265.2
KEYWORDS    RefSeq.
SOURCE      Eptesicus fuscus (big brown bat)
  ORGANISM  Eptesicus fuscus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Vespertilionidae; Eptesicus.
REFERENCE   1  (bases 1 to 79)
  AUTHORS   Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG and Ray
            DA.
  TITLE     Large numbers of novel miRNAs originate from DNA transposons and
            are coincident with a large species radiation in bats
  JOURNAL   Mol Biol Evol 31 (6), 1536-1545 (2014)
   PUBMED   24692655
REFERENCE   2  (bases 1 to 79)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JANZWY010000008.1.
            
            On Apr 17, 2019 this sequence version replaced NR_129265.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-79                JANZWY010000008.1  72359839-72359917
FEATURES             Location/Qualifiers
     source          1..79
                     /organism="Eptesicus fuscus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:29078"
                     /chromosome="11"
                     /map="11"
     gene            1..79
                     /gene="MIR375"
                     /gene_synonym="efu-mir-375"
                     /note="microRNA mir-375"
                     /db_xref="GeneID:104797193"
                     /db_xref="miRBase:MI0028891"
     precursor_RNA   1..79
                     /gene="MIR375"
                     /gene_synonym="efu-mir-375"
                     /product="microRNA mir-375"
                     /db_xref="GeneID:104797193"
                     /db_xref="miRBase:MI0028891"
     exon            1..79
                     /gene="MIR375"
                     /gene_synonym="efu-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           46..69
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="efu-mir-375"
                     /product="efu-miR-375"
                     /db_xref="miRBase:MIMAT0035180"
                     /db_xref="GeneID:104797193"
                     /db_xref="miRBase:MI0028891"
ORIGIN      

gctcccgccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggcaggggcgg

//