GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:11:44, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_125790                553 bp    RNA     linear   PRI 04-DEC-2018
DEFINITION  Homo sapiens CCND2 antisense RNA 1 (CCND2-AS1), transcript variant
            3, long non-coding RNA.
ACCESSION   NR_125790
VERSION     NR_125790.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 553)
  AUTHORS   Xia E, Bhandari A, Shen Y, Zhou X, Sindan N, Xiang J, Guan Y, Yang
            F and Wang O.
  TITLE     LncRNA CCND2-AS1 promotes proliferation, migration, and invasion in
            papillary thyroid carcinoma
  JOURNAL   Biochem. Biophys. Res. Commun. 496 (2), 628-632 (2018)
   PUBMED   29366479
  REMARK    GeneRIF: CCND2-AS1 expression was significantly over-expressed in
            papillary thyroid carcinoma cell lines compared to normal thyroid
            epithelial cells.
REFERENCE   2  (bases 1 to 553)
  AUTHORS   Zhang H, Wei DL, Wan L, Yan SF and Sun YH.
  TITLE     Highly expressed lncRNA CCND2-AS1 promotes glioma cell
            proliferation through Wnt/beta-catenin signaling
  JOURNAL   Biochem. Biophys. Res. Commun. 482 (4), 1219-1225 (2017)
   PUBMED   27923660
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC006122.24.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BG413373.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2142586, SAMEA2144120
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-126               AC006122.24        60049-60174
            127-553             AC006122.24        87040-87466
FEATURES             Location/Qualifiers
     source          1..553
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12p13.32"
     gene            1..553
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /note="CCND2 antisense RNA 1"
                     /db_xref="GeneID:103752584"
                     /db_xref="HGNC:HGNC:49398"
     ncRNA           1..553
                     /ncRNA_class="lncRNA"
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /product="CCND2 antisense RNA 1, transcript variant 3"
                     /db_xref="GeneID:103752584"
                     /db_xref="HGNC:HGNC:49398"
     exon            1..126
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /inference="alignment:Splign:2.1.0"
     variation       7
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751723166"
     variation       13
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055859383"
     variation       16
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487280180"
     variation       17
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345554353"
     variation       22
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233414806"
     variation       24
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766500677"
     variation       25
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763529306"
     variation       26
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867376054"
     variation       28
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773652105"
     variation       29
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765770986"
     variation       32
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762132499"
     variation       35
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776929300"
     variation       40
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759699380"
     variation       49
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311963474"
     variation       61
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771743347"
     variation       76
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745455734"
     variation       82
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200880354"
     variation       94
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770403051"
     variation       95
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019910889"
     variation       97
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748823991"
     variation       99
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1189680723"
     variation       103
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424514247"
     variation       106
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777614015"
     variation       111
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441700094"
     variation       121
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756058431"
     variation       124
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:878898553"
     exon            127..553
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /inference="alignment:Splign:2.1.0"
     variation       145
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1489896941"
     variation       152
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755432343"
     variation       155
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201682435"
     variation       166
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190637705"
     variation       180
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745420148"
     variation       188
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309847955"
     variation       192..193
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1375177872"
     variation       193
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780729624"
     variation       194
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148172200"
     variation       200..201
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1168183694"
     variation       209
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032061937"
     variation       218
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430319435"
     variation       224
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376312753"
     variation       231
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979597608"
     variation       235
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963666788"
     variation       236..238
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1369775559"
     variation       240
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756913420"
     variation       249
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537996828"
     variation       250
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345531082"
     variation       251
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381600856"
     variation       268
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024416310"
     variation       269
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568904740"
     variation       271
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891575312"
     variation       276
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891074718"
     variation       291
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025587610"
     variation       292
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935826005"
     variation       296
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774926547"
     variation       311
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292621910"
     variation       334
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:186263937"
     variation       335
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473943837"
     variation       341
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253342354"
     variation       345..351
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:932576665"
     variation       347
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993988307"
     variation       351
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203940541"
     variation       352..354
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:976522818"
     variation       352
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921942706"
     variation       359
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1442408171"
     variation       364..366
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="cac"
                     /db_xref="dbSNP:776088082"
     variation       364
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12318331"
     variation       365
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037753934"
     variation       366
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942149934"
     variation       368
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274496462"
     variation       369
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560645809"
     variation       375
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183381060"
     variation       384
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287104330"
     variation       391
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1387044601"
     variation       397
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382647860"
     variation       404
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1335858783"
     variation       407
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380247158"
     variation       408
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143750586"
     variation       409
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227954292"
     variation       410
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353708742"
     variation       412
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315962282"
     variation       415
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564728997"
     variation       419
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1290267864"
     variation       420
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027839491"
     variation       423
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349828797"
     variation       426..429
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1486480550"
     variation       439
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203521960"
     variation       441
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:918145635"
     variation       455
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241705576"
     variation       457
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296335457"
     variation       463
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988811244"
     variation       464
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970747168"
     variation       466
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935478063"
     variation       467
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569246364"
     variation       479
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364968945"
     variation       483
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374291176"
     variation       495
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:979201133"
     variation       496
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2358723"
     variation       497
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403691167"
     variation       506
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565423571"
     variation       507
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454360538"
     variation       514..515
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34898844"
     variation       520
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575450020"
     variation       525
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891506445"
     variation       529
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350188089"
     variation       532..539
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="taaa"
                     /replace="taaataaa"
                     /db_xref="dbSNP:547336966"
     variation       540
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565423567"
     variation       543
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389819681"
     variation       545
                     /gene="CCND2-AS1"
                     /gene_synonym="CCND2-AS2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191552531"
ORIGIN      
aatgcacagcttctccgcggtcagcgggctggtctctttgagtttggaggccaggaacatgcagacagcacccaggagttgcagatgggacttcggagtcgggaccccagccaagaaacggtccagaagaatctaccataaaaccaacagactcctcctgatctctacctgtgctgtctgcctctctagttccggacactgagagctggtgccctgtggccacctcaagctggaaccctgcaagatcaccaagaagactgcatgcctcgctctagccttcctaagggaaagtagactcctgtttttgagagaaattacctgatttcaagagaaacataaaggactttttttcccttaacattccactcgtaaaaatgaagtttggaagaacttctgcaaactctgagtgttttggtcaattgaccttttactgtactaagcaaatctgaagccacaaatacattggggaggaaggtatacccttcacaaaagatccgtcacttagccagatactctgttgccatgcttctttaaataaagcacatttctggta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]