GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 22:42:13, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_125761                560 bp    RNA     linear   PRI 04-DEC-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 1461
            (LINC01461), long non-coding RNA.
ACCESSION   NR_125761
VERSION     NR_125761.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 560)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC114482.2 and AL359762.24.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA091614.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2158188 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-275               AC114482.2         7437-7711           c
            276-427             AC114482.2         5413-5564           c
            428-560             AL359762.24        108209-108341       c
FEATURES             Location/Qualifiers
     source          1..560
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p22.3"
     gene            1..560
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /note="long intergenic non-protein coding RNA 1461"
                     /db_xref="GeneID:103695366"
                     /db_xref="HGNC:HGNC:50859"
     ncRNA           1..560
                     /ncRNA_class="lncRNA"
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /product="long intergenic non-protein coding RNA 1461"
                     /db_xref="GeneID:103695366"
                     /db_xref="HGNC:HGNC:50859"
     exon            1..275
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946035838"
     variation       4
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930200042"
     variation       11
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439740611"
     variation       13
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453211533"
     variation       14
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553477077"
     variation       17
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214265894"
     variation       23
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918883506"
     variation       24
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463379863"
     variation       25
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:914561896"
     variation       30
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373275438"
     variation       36
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472284746"
     variation       37
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160910269"
     variation       44
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1415361166"
     variation       46
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962920072"
     variation       51
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054427668"
     variation       64
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936586398"
     variation       71
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926573535"
     variation       72
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:980547508"
     variation       74..75
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1244369854"
     variation       74
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952996966"
     variation       75
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970978040"
     variation       78
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539924609"
     variation       82
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1029989430"
     variation       86
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233751938"
     variation       91
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1267421542"
     variation       94
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:574707378"
     variation       96
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903097146"
     variation       101
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57771687"
     variation       103
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219489280"
     variation       106
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151290295"
     variation       122
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143337633"
     variation       123
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:57502810"
     variation       124
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:921157131"
     variation       126
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:953591717"
     variation       128
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1475248360"
     variation       129
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029266928"
     variation       133
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001559044"
     variation       134
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456147121"
     variation       139
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997667000"
     variation       142
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557438431"
     variation       152
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:902017926"
     variation       157
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386160087"
     variation       160
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539084862"
     variation       165
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571421651"
     variation       174
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357673957"
     variation       176
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041766777"
     variation       185
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010735285"
     variation       186
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:893257743"
     variation       187
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287863754"
     variation       189
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054374959"
     variation       193
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:930025721"
     variation       195
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2945136"
     variation       196
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926509962"
     variation       200
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198589415"
     variation       201
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1044967190"
     variation       207
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485824862"
     variation       208
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359839877"
     variation       210
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949206103"
     variation       213
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471867013"
     variation       216
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1184616283"
     variation       218
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1156232918"
     variation       219
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1465850633"
     variation       221
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12067196"
     variation       222
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368675310"
     variation       226
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186466077"
     variation       233
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1435605504"
     variation       234
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971955154"
     variation       238..240
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:35950527"
     variation       238
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255803729"
     variation       239
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348725562"
     variation       241
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:940421244"
     variation       243
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307616366"
     variation       244
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1330511663"
     variation       248
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230769882"
     variation       254
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196312549"
     variation       257
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305409417"
     variation       260
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348100615"
     variation       261
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908985707"
     variation       272
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984432111"
     variation       274
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:985655286"
     variation       275
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483751723"
     exon            276..427
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /inference="alignment:Splign:2.1.0"
     variation       284
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218877197"
     variation       297
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:925501343"
     variation       306
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887278984"
     variation       314
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:981010249"
     variation       323
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969500722"
     variation       327
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238993704"
     variation       331
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778280210"
     variation       335
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048635829"
     variation       350
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1351540599"
     variation       352
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379460518"
     variation       353
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760302673"
     variation       354
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921379596"
     variation       360
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960048974"
     variation       363
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331822375"
     variation       365
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545654573"
     variation       372
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438274851"
     variation       377
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015348448"
     variation       378
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323744186"
     variation       392
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331177395"
     variation       394
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1313077235"
     variation       398
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414009702"
     variation       399
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1353469188"
     variation       403
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039680934"
     variation       422
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003842910"
     variation       427
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888130217"
     exon            428..560
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /inference="alignment:Splign:2.1.0"
     variation       428
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202376786"
     variation       432
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1557431298"
     variation       448
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270659330"
     variation       457
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022933591"
     variation       461
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243754854"
     variation       465
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293638145"
     variation       473
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186830558"
     variation       476
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215362043"
     variation       485
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753714555"
     variation       496
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763827581"
     variation       510
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034782015"
     variation       512
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760470265"
     variation       513
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193305207"
     variation       515
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1367432644"
     variation       517
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565244914"
     variation       518
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472738797"
     variation       526
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003323401"
     variation       530
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774451423"
     variation       543
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425704781"
     variation       549
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545436748"
     variation       550
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1425964911"
     variation       554
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771076880"
     variation       557
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474951969"
     variation       560
                     /gene="LINC01461"
                     /gene_synonym="TCONS_00001552"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576648569"
ORIGIN      
tctcagcgtcctctccggtggaggacagaaggcatcccagggtcgcgggagagccagcgcaaagtggaaggcaccttgtacgctgtgaagcggagatgcagatgttaccctaaccagaagcccaccccgccacaaatactggagcgcccagcatgcgtgcgccacccgcttccctgcagagggcgccgcgggcccgcctcgccgagcgcggggtgagatcccagtagcccagagcagcccgcggggcaggcccgggctgccgcggactcctcttgcagaaaagcctttgatgctgtattcttagcacatggaaccctaaaccaaagcctgcactggggcatttgtgagaagcgtgtgtgcaaagcctgagagactccccttttgggcatgctgctgggcaggggtgttctggtttgactttgtacatttggcagttttggagtttgcccaccagatatgccatccaagaagaccaaaagtacagcaggatgattgtgaacaagaccagggacctcagcccttgcaaaaaaaggttgaagactatgtacatgaacgacatt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]