GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:21:15, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_122033               2142 bp    RNA     linear   PRI 04-DEC-2018
DEFINITION  Homo sapiens KRBOX1 antisense RNA 1 (KRBOX1-AS1), long non-coding
            RNA.
ACCESSION   NR_122033
VERSION     NR_122033.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2142)
  AUTHORS   Ota T, Suzuki Y, Nishikawa T, Otsuki T, Sugiyama T, Irie R,
            Wakamatsu A, Hayashi K, Sato H, Nagai K, Kimura K, Makita H, Sekine
            M, Obayashi M, Nishi T, Shibahara T, Tanaka T, Ishii S, Yamamoto J,
            Saito K, Kawai Y, Isono Y, Nakamura Y, Nagahari K, Murakami K,
            Yasuda T, Iwayanagi T, Wagatsuma M, Shiratori A, Sudo H, Hosoiri T,
            Kaku Y, Kodaira H, Kondo H, Sugawara M, Takahashi M, Kanda K, Yokoi
            T, Furuya T, Kikkawa E, Omura Y, Abe K, Kamihara K, Katsuta N, Sato
            K, Tanikawa M, Yamazaki M, Ninomiya K, Ishibashi T, Yamashita H,
            Murakawa K, Fujimori K, Tanai H, Kimata M, Watanabe M, Hiraoka S,
            Chiba Y, Ishida S, Ono Y, Takiguchi S, Watanabe S, Yosida M, Hotuta
            T, Kusano J, Kanehori K, Takahashi-Fujii A, Hara H, Tanase TO,
            Nomura Y, Togiya S, Komai F, Hara R, Takeuchi K, Arita M, Imose N,
            Musashino K, Yuuki H, Oshima A, Sasaki N, Aotsuka S, Yoshikawa Y,
            Matsunawa H, Ichihara T, Shiohata N, Sano S, Moriya S, Momiyama H,
            Satoh N, Takami S, Terashima Y, Suzuki O, Nakagawa S, Senoh A,
            Mizoguchi H, Goto Y, Shimizu F, Wakebe H, Hishigaki H, Watanabe T,
            Sugiyama A, Takemoto M, Kawakami B, Yamazaki M, Watanabe K, Kumagai
            A, Itakura S, Fukuzumi Y, Fujimori Y, Komiyama M, Tashiro H,
            Tanigami A, Fujiwara T, Ono T, Yamada K, Fujii Y, Ozaki K, Hirao M,
            Ohmori Y, Kawabata A, Hikiji T, Kobatake N, Inagaki H, Ikema Y,
            Okamoto S, Okitani R, Kawakami T, Noguchi S, Itoh T, Shigeta K,
            Senba T, Matsumura K, Nakajima Y, Mizuno T, Morinaga M, Sasaki M,
            Togashi T, Oyama M, Hata H, Watanabe M, Komatsu T, Mizushima-Sugano
            J, Satoh T, Shirai Y, Takahashi Y, Nakagawa K, Okumura K, Nagase T,
            Nomura N, Kikuchi H, Masuho Y, Yamashita R, Nakai K, Yada T,
            Nakamura Y, Ohara O, Isogai T and Sugano S.
  TITLE     Complete sequencing and characterization of 21,243 full-length
            human cDNAs
  JOURNAL   Nat. Genet. 36 (1), 40-45 (2004)
   PUBMED   14702039
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC092043.3.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK057338.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148874
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1029              AC092043.3         139587-140615       c
            1030-2142           AC092043.3         138074-139186       c
FEATURES             Location/Qualifiers
     source          1..2142
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p22.1"
     gene            1..2142
                     /gene="KRBOX1-AS1"
                     /note="KRBOX1 antisense RNA 1"
                     /db_xref="GeneID:100506275"
                     /db_xref="HGNC:HGNC:42942"
     ncRNA           1..2142
                     /ncRNA_class="lncRNA"
                     /gene="KRBOX1-AS1"
                     /product="KRBOX1 antisense RNA 1"
                     /db_xref="GeneID:100506275"
                     /db_xref="HGNC:HGNC:42942"
     exon            1..1029
                     /gene="KRBOX1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184081790"
     variation       18..22
                     /gene="KRBOX1-AS1"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:34257673"
     variation       21
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994982726"
     variation       23
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334599734"
     variation       26
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772506155"
     variation       27
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534198980"
     variation       29
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:568360618"
     variation       30
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003626790"
     variation       32
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278216989"
     variation       33
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331797423"
     variation       34
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144999716"
     variation       36
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201344290"
     variation       37
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150999084"
     variation       38
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002729335"
     variation       41
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193198463"
     variation       43
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424504086"
     variation       45..55
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="tctgttgatag"
                     /db_xref="dbSNP:1376950743"
     variation       48
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478826771"
     variation       53
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947943612"
     variation       58
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046977469"
     variation       60
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569652807"
     variation       65
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174049174"
     variation       72
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893710888"
     variation       80
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382345920"
     variation       83
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1053573571"
     variation       91
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298431478"
     variation       98
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1417804043"
     variation       101
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402497701"
     variation       108
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299854318"
     variation       114..120
                     /gene="KRBOX1-AS1"
                     /replace="tgtgt"
                     /replace="tgtgtgt"
                     /db_xref="dbSNP:1167753794"
     variation       119
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935176811"
     variation       124
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234437246"
     variation       129
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258197396"
     variation       134
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351955111"
     variation       134
                     /gene="KRBOX1-AS1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:887328497"
     variation       138
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769204417"
     variation       140
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182015081"
     variation       146
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288373"
     variation       149
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532803796"
     variation       150
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433647990"
     variation       151
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920287850"
     variation       156
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243878567"
     variation       158
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564053910"
     variation       164
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540244432"
     variation       165
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973107801"
     variation       169
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158892981"
     variation       171
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746814506"
     variation       172..177
                     /gene="KRBOX1-AS1"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:1287050709"
     variation       172
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866040318"
     variation       173
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1367678941"
     variation       174
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911874791"
     variation       176
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954570651"
     variation       177
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1239814858"
     variation       180
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1020880785"
     variation       181
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986396470"
     variation       185
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988091287"
     variation       188
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953641361"
     variation       191
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1271175731"
     variation       199
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192893913"
     variation       204
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:547296385"
     variation       207
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438883236"
     variation       214
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178945271"
     variation       218
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111782205"
     variation       220..221
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="gagcc"
                     /db_xref="dbSNP:1163629141"
     variation       223..224
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1350002403"
     variation       225
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905249014"
     variation       226
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025068088"
     variation       231
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527577115"
     variation       234
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372488829"
     variation       241
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446514434"
     variation       242
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1310376817"
     variation       244
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341247091"
     variation       245
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014134433"
     variation       246
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2288372"
     variation       249
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777520692"
     variation       251
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003269762"
     variation       254
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970380158"
     variation       256
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338205853"
     variation       259
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023285842"
     variation       260
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457217636"
     variation       261
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:936359622"
     variation       262
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199177821"
     variation       263
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037743498"
     variation       266
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943057092"
     variation       275
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180972782"
     variation       276..288
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="gtagccacacccg"
                     /db_xref="dbSNP:1422126868"
     variation       277
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011849999"
     variation       280..316
                     /gene="KRBOX1-AS1"
                     /replace="cc"
                     /replace="ccacacccgcctccctcggggctgtttcccgtcctcc"
                     /db_xref="dbSNP:1422126346"
     variation       285
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893764659"
     variation       287
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425073930"
     variation       288
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576159421"
     variation       296
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:999774754"
     variation       297
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902305685"
     variation       299
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562857360"
     variation       301
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:913766795"
     variation       304
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042214246"
     variation       307
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944781154"
     variation       308
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446253308"
     variation       309
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302515267"
     variation       310
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380074079"
     variation       316
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911968341"
     variation       320
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050453624"
     variation       322
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191680579"
     variation       325
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444282066"
     variation       328
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317369744"
     variation       331
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920852281"
     variation       332
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219216866"
     variation       339
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385939108"
     variation       340
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185561600"
     variation       344
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973639838"
     variation       345
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369485947"
     variation       350
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908006280"
     variation       355
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577198219"
     variation       356
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205162894"
     variation       373
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:981148440"
     variation       374
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756796496"
     variation       375
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172080668"
     variation       378
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025470439"
     variation       384
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413123473"
     variation       386
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287513913"
     variation       387
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:553745357"
     variation       388
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559386950"
     variation       389
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359780783"
     variation       389
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="ggg"
                     /db_xref="dbSNP:1360092925"
     variation       390
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011902492"
     variation       391
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416927884"
     variation       392
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296547273"
     variation       396
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751239281"
     variation       400
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237246187"
     variation       401
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400637161"
     variation       405
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372025994"
     variation       406
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271892392"
     variation       413
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342706820"
     variation       415
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534260593"
     variation       416
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279137346"
     variation       417
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73832408"
     variation       418
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284842012"
     variation       419
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1488346259"
     variation       426
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032677625"
     variation       433
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999427563"
     variation       434
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191115049"
     variation       435
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301757153"
     variation       438
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436946130"
     variation       440
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424249591"
     variation       445
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366366180"
     variation       447
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528747671"
     variation       455..462
                     /gene="KRBOX1-AS1"
                     /replace="actg"
                     /replace="actgactg"
                     /db_xref="dbSNP:1435756075"
     variation       455
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420390094"
     variation       461
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040905762"
     variation       465
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275343187"
     variation       469
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147142385"
     variation       470
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538074759"
     variation       476..481
                     /gene="KRBOX1-AS1"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1353898873"
     variation       480
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1284909805"
     variation       483
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206511688"
     variation       484
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1287207362"
     variation       490
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450505916"
     variation       501
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933080915"
     variation       502
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247749366"
     variation       508
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913673591"
     variation       510
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177090675"
     variation       514
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266489153"
     variation       521
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440611927"
     variation       522
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1160508589"
     variation       539
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050463405"
     variation       541
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388721546"
     variation       542
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931979412"
     variation       545
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187230675"
     variation       551
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936498923"
     variation       555
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490452526"
     variation       557
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:925155229"
     variation       565
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1308328900"
     variation       567
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377355445"
     variation       568
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293447962"
     variation       570
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282040374"
     variation       571
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355063019"
     variation       573
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980754383"
     variation       576
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274358223"
     variation       578
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1284394222"
     variation       578
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315793018"
     variation       579
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470176671"
     variation       588
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197288866"
     variation       590
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1238025999"
     variation       594
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438722287"
     variation       597
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1184313525"
     variation       598
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038379277"
     variation       608
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163849285"
     variation       609
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288371"
     variation       614
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464056558"
     variation       618
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908106989"
     variation       619
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539518516"
     variation       621
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970867355"
     variation       623
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281946995"
     variation       624
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025690332"
     variation       634
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1294657529"
     variation       635
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561279044"
     variation       650
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995593435"
     variation       651
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765251728"
     variation       654
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1257958587"
     variation       655
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340530685"
     variation       659
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197888380"
     variation       666
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:182641202"
     variation       673
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442114693"
     variation       674
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018934766"
     variation       675
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259746574"
     variation       678
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476868257"
     variation       679
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957712448"
     variation       684
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1169901416"
     variation       685
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373530320"
     variation       692
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031981784"
     variation       696
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888762222"
     variation       700
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:978141088"
     variation       702
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401219220"
     variation       706
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344679133"
     variation       715
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1314302033"
     variation       716
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1051407269"
     variation       717
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:865842"
     variation       719
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278157600"
     variation       731
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327467031"
     variation       732
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230093931"
     variation       737..738
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1211922677"
     variation       738
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402534505"
     variation       739
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019949511"
     variation       744
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487366026"
     variation       745
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192953181"
     variation       753
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262359291"
     variation       765
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430298227"
     variation       769
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527240654"
     variation       777
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892179181"
     variation       778
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008069588"
     variation       790
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175659436"
     variation       800..804
                     /gene="KRBOX1-AS1"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:1175153849"
     variation       811
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889591505"
     variation       813
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753900430"
     variation       821
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568386753"
     variation       840
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:936479234"
     variation       841
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029096899"
     variation       842
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288370"
     variation       843
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899228908"
     variation       844
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760756465"
     variation       846
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299789332"
     variation       849
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037736291"
     variation       853
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184377702"
     variation       855
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:940680645"
     variation       860
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235428944"
     variation       866
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886733535"
     variation       874
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485379946"
     variation       876
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047046375"
     variation       879
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949562292"
     variation       885
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242181219"
     variation       892
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375440933"
     variation       907
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486871924"
     variation       908
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562682001"
     variation       911
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992082292"
     variation       913
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266530866"
     variation       917
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951391915"
     variation       920
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373783522"
     variation       921
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378118019"
     variation       926
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936447085"
     variation       930
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111731311"
     variation       937
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159335378"
     variation       943..950
                     /gene="KRBOX1-AS1"
                     /replace="cagt"
                     /replace="cagtcagt"
                     /db_xref="dbSNP:974167408"
     variation       951
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455889891"
     variation       956..957
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34213366"
     variation       965
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292321405"
     variation       970
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190788430"
     variation       995
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324676515"
     variation       1007
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285657460"
     variation       1011
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380728694"
     variation       1014
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442116654"
     variation       1017
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361458422"
     variation       1018
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239747246"
     variation       1023
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018473334"
     variation       1025
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540234842"
     exon            1030..2142
                     /gene="KRBOX1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       1040
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1244292646"
     variation       1042
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477245242"
     variation       1050..1054
                     /gene="KRBOX1-AS1"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1396054122"
     variation       1052
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445928391"
     variation       1055
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1559386723"
     variation       1060
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455797487"
     variation       1061
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17388512"
     variation       1074
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1005346653"
     variation       1079..1081
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="cac"
                     /db_xref="dbSNP:1480500117"
     variation       1081
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:6768791"
     variation       1090
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024953355"
     variation       1095
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207558334"
     variation       1102
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548217912"
     variation       1111
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320244244"
     variation       1112
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013525326"
     variation       1118
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347983120"
     variation       1121
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439915076"
     variation       1122
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326400892"
     variation       1127
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559386700"
     variation       1128
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778854485"
     variation       1134
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237565222"
     variation       1138
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278572174"
     variation       1143
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350798209"
     variation       1165
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903564378"
     variation       1167
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:531632547"
     variation       1169
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023814505"
     variation       1183..1187
                     /gene="KRBOX1-AS1"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1314648685"
     variation       1192
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75885972"
     variation       1207..1226
                     /gene="KRBOX1-AS1"
                     /replace="t"
                     /replace="tctgatgtaagacaggcact"
                     /db_xref="dbSNP:879450099"
     variation       1209
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:552356933"
     variation       1217
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896349717"
     variation       1222
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254062635"
     variation       1233
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470088691"
     variation       1242
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001051662"
     variation       1244
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532127789"
     variation       1260
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056293079"
     variation       1272
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160317333"
     variation       1275
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189035455"
     variation       1284
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374261520"
     variation       1296
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165553725"
     variation       1302
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396481507"
     variation       1304
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:897090864"
     variation       1307
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1309681884"
     variation       1316
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573811662"
     variation       1317
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751950210"
     variation       1319
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335934406"
     variation       1323
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038309807"
     variation       1342
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941359499"
     variation       1351
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364492708"
     variation       1353
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233273627"
     variation       1355
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1274291578"
     variation       1361
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945145038"
     variation       1362
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311453591"
     variation       1363
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554944595"
     variation       1367
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1050783380"
     variation       1376
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138904501"
     variation       1380
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:921185395"
     variation       1390
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530068743"
     variation       1394
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255575724"
     variation       1395
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:561312389"
     variation       1409
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188581551"
     variation       1410
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419897336"
     variation       1411
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377647106"
     variation       1418
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167163858"
     variation       1423
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1396907523"
     variation       1426
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411374019"
     variation       1432
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544621195"
     variation       1435..1442
                     /gene="KRBOX1-AS1"
                     /replace="catca"
                     /replace="catcatca"
                     /db_xref="dbSNP:1354284517"
     variation       1438
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419074204"
     variation       1440
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331778298"
     variation       1458
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251676366"
     variation       1466
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370563696"
     variation       1471
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414796762"
     variation       1475
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294475723"
     variation       1481
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357858773"
     variation       1492
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962587524"
     variation       1496
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251145054"
     variation       1499
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908347377"
     variation       1506
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988994651"
     variation       1512
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197832971"
     variation       1515
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278386941"
     variation       1521
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956254094"
     variation       1526
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575906060"
     variation       1533
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146078625"
     variation       1540
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259681213"
     variation       1541
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:950891922"
     variation       1543
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184050369"
     variation       1546
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192380280"
     variation       1547
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373492984"
     variation       1551
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979088330"
     variation       1552
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171368669"
     variation       1561
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569299315"
     variation       1563
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223530613"
     variation       1564
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013577566"
     variation       1569
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959334245"
     variation       1576
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358036248"
     variation       1577
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381084270"
     variation       1582
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358520395"
     variation       1585
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548452676"
     variation       1587
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295476349"
     variation       1594
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1023381606"
     variation       1599
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79558555"
     variation       1602
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1238222837"
     variation       1614
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347496833"
     variation       1625
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138205412"
     variation       1641
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904088350"
     variation       1648
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984049549"
     variation       1653..1655
                     /gene="KRBOX1-AS1"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1402826690"
     variation       1654
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042980521"
     variation       1679
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533851764"
     variation       1680
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114155973"
     variation       1683
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890919764"
     variation       1684
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448553215"
     variation       1687
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050793051"
     variation       1688
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554538391"
     variation       1690
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:796136763"
     variation       1691
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1175121358"
     variation       1692
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453874602"
     variation       1709
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361617596"
     variation       1715
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038307634"
     variation       1721
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452356745"
     variation       1728
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364815100"
     variation       1730
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373803340"
     variation       1734
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296163595"
     variation       1741
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763280877"
     variation       1749
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767771273"
     variation       1753
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324349869"
     variation       1755
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370714699"
     variation       1757
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889822379"
     variation       1758
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559386600"
     variation       1759
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1049815272"
     variation       1762
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537402197"
     variation       1768
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145663909"
     variation       1775
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559386595"
     variation       1787
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908441361"
     variation       1792
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352810237"
     variation       1809
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211707095"
     variation       1820
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252214786"
     variation       1821
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468737237"
     variation       1831
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195122352"
     variation       1840
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200406837"
     variation       1851
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774635053"
     variation       1875
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1418028233"
     variation       1877
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159264582"
     variation       1880
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559386581"
     variation       1885
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983053741"
     variation       1898
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053241789"
     variation       1899
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934824876"
     variation       1907
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76854855"
     variation       1920
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918001802"
     variation       1921..1926
                     /gene="KRBOX1-AS1"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1394224856"
     variation       1943
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442015776"
     variation       1947
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295539154"
     variation       1949
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371395450"
     variation       1950
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1391018159"
     variation       1955
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992177499"
     variation       1957
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763403414"
     variation       1959
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967721564"
     variation       1960..1963
                     /gene="KRBOX1-AS1"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1269884911"
     variation       1963
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538459538"
     variation       1970
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:979446089"
     variation       1975
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322528447"
     variation       1976
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215287522"
     variation       1988
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539136501"
     variation       1999
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140872159"
     variation       2000
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177424090"
     variation       2002
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252124755"
     variation       2006
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438154842"
     variation       2022
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1186433060"
     variation       2024
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1417726770"
     variation       2030
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462315833"
     variation       2035
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1167410342"
     variation       2037
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1021205485"
     variation       2041
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1010152687"
     variation       2046
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324264124"
     variation       2049
                     /gene="KRBOX1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765426640"
     variation       2052
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317203376"
     variation       2053
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148069517"
     variation       2054
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78991151"
     variation       2063
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770245515"
     variation       2087
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323115107"
     variation       2090
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468762650"
     variation       2091
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235032165"
     variation       2099
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190424847"
     variation       2103
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293264581"
     variation       2105
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306694060"
     variation       2109
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996574723"
     variation       2113
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:550958448"
     variation       2114
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1429011217"
     variation       2115
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185985975"
     variation       2123
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479210918"
     variation       2129
                     /gene="KRBOX1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941027531"
     variation       2130
                     /gene="KRBOX1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050170824"
     variation       2140
                     /gene="KRBOX1-AS1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1447629434"
ORIGIN      
atccgggtcaaagacaagggggctggagcgaccgaggggcatgttctgttgatagaagattctggagtgtggacagttaaaactttttgtgggcttcgaagttaacatgcgaatgtgtgtcagtatccgactctgagtgggccacaggctgccctgggtacagggaaacgaggggggtgggagcctgcggccagcgttccaggcctctgccagcgccgcatctcgacgctacagagccaagctcggggatcggcatgaggaccccagtaccagcagtagccacacccgcctccctcggggctgtttcccgtcctcctcagacccgctcaccgtgggctcctggcggcctctgcagcttttcagcaagcagagatggtgggcgccactcgccgatcctcacaaaccaaaacctcgcgcgacaaaaacgaaggcggccccggaagtgcgtcatcacactgactggtgaacccatacactctctggatttctctctaggactcgtggaggaccccacatcttggtgcttccctcctaattcccgtgaggaaaagggcacgctggcgagataggctcttggcgttcctccagagcccagttctgagttgaggcaccttgctcatgacgctgcatcatcgtaccaaccttgaatactggcttccagtgcctttattactgtgctacaataactgcaactacaagtcttacccagaatatgcaagaaaatgtgaatggttatacgttttattgatcttgttaaatttagcatttggattgttatagcataatgaacgaatcacacattatacaaccaggacttctcttgaattgctgtaatgattgcactcctagaatgtgatgtctttcaatgttgctgacgcctctcacttccatacattaccactagcagagaggattagcaatggaccatgggcaaagtgagagcagtcagtttacccaagaaatattcatcccctgtccagcagagcttaacactgtcccaggaaaacagcatgactacatcaatcagagggtttttaaaagtgtgattctttttgaaaaatcaagaaattcaccttctcacgatgtagaaaactgaaaagtgcatggcctcacccttacaacaacaaaaaacagccagataatctaaaattttctcttgaacacatcagaaagctaagatctgggggcaaacgacttaatctaaaatctgatgtaagacaggcactttcaagaagagatggttgtaagcacttgtttacataggacagatgccattggatgccatgtaagctgttaaggagaaatcagctaaaatgtttaatgagttgctgaggtccaagtgttggctagcctgagaatatagagactacagaactcctgtgaaccacagacacaagcagaatttccacccacttgtatattcttctctatggacatcatcaaatgtgtgcacacacacatacacacatacaattgaaggtaaggcaagaagaatcttatgaaaaccttcccgctagaaaagacatgaatccccatccaggtccttctctcctatttcccctacagaacaaaagccctaagcctctgaggatgaaaaagcaaatcttgtcacccttagggactggttaagatccagtggaactgaagggaataaagagaacaaaaagctctccattcacgaaatagcggtagaattgcatcctggttccagaccatggaggtgtcctacagctgaggatagggcaacatcacttaatagaccccacccttaagtctcagagacacagtgcctacctaagattaaagctgaatcacaacagaaaatgccatcccttctaccaccaccaaaatatcaaatgctgagtcaataagaacagcaatctactgctaaaagaaggataaaaacatggagaaagacccctctctgaggtacaggaatgaagggaaggcctaaaggtaagagtggtgcaaacattgagaaaatctcctttagcaaaccatcccacacactaaacttaaggtaatactagaagaatttgaagcctgtggataaccatagcaacaaaaacacctaaacacagtttaactcctgattagatcaactcaagccttcacaataaagatctaccgaaagaaaaagta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]