GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:24:14, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_120624               1014 bp    RNA     linear   PRI 27-NOV-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 2620
            (LINC02620), long non-coding RNA.
ACCESSION   NR_120624 XR_246183 XR_247592 XR_252814
VERSION     NR_120624.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL161646.10.
            On or before Jun 5, 2014 this sequence version replaced
            XR_246183.1, XR_247592.1, XR_252814.1.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC039476.1, BM453629.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1968540, SAMEA2147920
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-143               AL161646.10        10777-10919         c
            144-299             AL161646.10        7546-7701           c
            300-1014            AL161646.10        5583-6297           c
FEATURES             Location/Qualifiers
     source          1..1014
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q25.1"
     gene            1..1014
                     /gene="LINC02620"
                     /note="long intergenic non-protein coding RNA 2620"
                     /db_xref="GeneID:101927523"
                     /db_xref="HGNC:HGNC:54097"
     ncRNA           1..1014
                     /ncRNA_class="lncRNA"
                     /gene="LINC02620"
                     /product="long intergenic non-protein coding RNA 2620"
                     /db_xref="GeneID:101927523"
                     /db_xref="HGNC:HGNC:54097"
     exon            1..143
                     /gene="LINC02620"
                     /inference="alignment:Splign:2.1.0"
     variation       3
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558923768"
     variation       5
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287954188"
     variation       13
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529986550"
     variation       16..17
                     /gene="LINC02620"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1232295789"
     variation       16
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763319137"
     variation       37
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753256616"
     variation       45
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479578295"
     variation       50
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180303358"
     variation       51
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053931466"
     variation       62
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238521100"
     variation       70
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1564914362"
     variation       82
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1443752891"
     variation       90
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161339319"
     variation       93
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009739420"
     variation       97
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765736541"
     variation       111
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:573405162"
     variation       114
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445146538"
     variation       115
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:998181279"
     variation       119
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378161556"
     variation       122
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282697703"
     variation       127..136
                     /gene="LINC02620"
                     /replace="aagaaga"
                     /replace="aagaagaaga"
                     /db_xref="dbSNP:146489702"
     variation       129
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553377252"
     variation       131
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112763237"
     variation       133
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425844512"
     variation       135..137
                     /gene="LINC02620"
                     /replace=""
                     /replace="gat"
                     /db_xref="dbSNP:1200499650"
     variation       135
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378840530"
     variation       138
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440813081"
     variation       140
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941249107"
     variation       142
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045321841"
     variation       143
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949606602"
     exon            144..299
                     /gene="LINC02620"
                     /inference="alignment:Splign:2.1.0"
     variation       145..149
                     /gene="LINC02620"
                     /replace="agtta"
                     /replace="agttagtta"
                     /db_xref="dbSNP:780566478"
     variation       145
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1470675719"
     variation       146
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357226743"
     variation       154
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028121692"
     variation       156
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996617266"
     variation       157
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778101593"
     variation       160
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019770406"
     variation       166
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73339105"
     variation       183
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147622684"
     variation       196
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346524474"
     variation       197
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145221214"
     variation       199
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034710282"
     variation       203
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181568861"
     variation       204
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043322318"
     variation       209
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444590923"
     variation       210
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529464667"
     variation       211
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563951422"
     variation       216..225
                     /gene="LINC02620"
                     /replace="ttgttgt"
                     /replace="ttgttgttgt"
                     /db_xref="dbSNP:1243699180"
     variation       218
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188578622"
     variation       220
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390951431"
     variation       223..226
                     /gene="LINC02620"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:566371119"
     variation       226
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171792607"
     variation       250..251
                     /gene="LINC02620"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1415019595"
     variation       261
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564913685"
     variation       265
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456505087"
     variation       266
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249993852"
     variation       267
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1196592459"
     variation       270
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866181423"
     variation       275
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78934294"
     variation       279
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262951558"
     variation       280
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341779165"
     variation       290
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543539447"
     variation       291
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1264021333"
     variation       292
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971648257"
     variation       293
                     /gene="LINC02620"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1231476193"
     exon            300..1014
                     /gene="LINC02620"
                     /inference="alignment:Splign:2.1.0"
     variation       300
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206958604"
     variation       302
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325001794"
     variation       311
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331160264"
     variation       315
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781316191"
     variation       317
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546003791"
     variation       318
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946305041"
     variation       320..321
                     /gene="LINC02620"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1349023018"
     variation       323
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576980717"
     variation       324
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290848016"
     variation       333
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246582063"
     variation       335
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987604288"
     variation       336
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:944708911"
     variation       341
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139005892"
     variation       347
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533919722"
     variation       348
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574472985"
     variation       350
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973797462"
     variation       351
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10884003"
     variation       352..355
                     /gene="LINC02620"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:201450643"
     variation       357
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004771294"
     variation       360
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145129505"
     variation       363
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182578976"
     variation       366
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024774732"
     variation       367
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:989863774"
     variation       369
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403413845"
     variation       370
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:570348556"
     variation       378
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1390916519"
     variation       379
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012125728"
     variation       386
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550071105"
     variation       389
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937071694"
     variation       391
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142949942"
     variation       395
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926974971"
     variation       408
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412104221"
     variation       410
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981544328"
     variation       414
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:971069884"
     variation       415
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289422069"
     variation       417
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340231893"
     variation       418
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778048628"
     variation       422
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053565880"
     variation       436
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758218385"
     variation       437
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357157369"
     variation       447
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7097648"
     variation       448
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547483044"
     variation       452
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527821948"
     variation       453
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564913390"
     variation       457
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255285190"
     variation       458
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042455917"
     variation       463
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:946266030"
     variation       465
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156235566"
     variation       472
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78025564"
     variation       473
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408153094"
     variation       474..477
                     /gene="LINC02620"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1051873371"
     variation       475
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1183891725"
     variation       485
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391451749"
     variation       490
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479275138"
     variation       491
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432230938"
     variation       493
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547673387"
     variation       494
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138245591"
     variation       506
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150431674"
     variation       507
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973487437"
     variation       511
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867575559"
     variation       524
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900614107"
     variation       526
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336425095"
     variation       528
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489398253"
     variation       539
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019008637"
     variation       544
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227904099"
     variation       545
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295561132"
     variation       550
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344393437"
     variation       551
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756932391"
     variation       554
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:531835737"
     variation       555
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545641124"
     variation       565
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902503103"
     variation       572
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042036167"
     variation       574
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532342284"
     variation       576
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983860254"
     variation       589
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970629958"
     variation       592
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464193680"
     variation       595
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024929583"
     variation       599
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249419564"
     variation       605
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990637828"
     variation       611
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171742821"
     variation       617
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377512608"
     variation       624
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:945947973"
     variation       627
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1407269049"
     variation       630
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032604356"
     variation       631
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318782257"
     variation       637
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345143349"
     variation       638
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892993081"
     variation       640
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054192149"
     variation       641
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532348980"
     variation       643
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927070109"
     variation       644
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:981212837"
     variation       649
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235287207"
     variation       657
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949790099"
     variation       659
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256420674"
     variation       666
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1564913353"
     variation       667
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:540313309"
     variation       668
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454824812"
     variation       669
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388688190"
     variation       674
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328217819"
     variation       681
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:907494740"
     variation       698
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206441440"
     variation       700
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763641380"
     variation       702
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020618277"
     variation       705
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160806966"
     variation       712
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:952244920"
     variation       713
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1027895857"
     variation       715
                     /gene="LINC02620"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1428202357"
     variation       716
                     /gene="LINC02620"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1201632834"
     variation       718
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430516011"
     variation       720
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74157122"
     variation       727..728
                     /gene="LINC02620"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1391050173"
     variation       728
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554238793"
     variation       735..738
                     /gene="LINC02620"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1454404611"
     variation       740
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434697899"
     variation       760
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259464015"
     variation       766
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964869915"
     variation       773
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388512072"
     variation       774
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019479936"
     variation       775
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008950408"
     variation       776
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902516916"
     variation       803..804
                     /gene="LINC02620"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1486184338"
     variation       806
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220344292"
     variation       815
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270043295"
     variation       819
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1020932485"
     variation       822
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1489174067"
     variation       825
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010124933"
     variation       837
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038281533"
     variation       838..840
                     /gene="LINC02620"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1472481588"
     variation       848
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180425136"
     variation       860
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:879644772"
     variation       863
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752026321"
     variation       864
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164331026"
     variation       866
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235774115"
     variation       870
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459453645"
     variation       871
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1303709269"
     variation       872
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565043709"
     variation       873
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983442908"
     variation       878
                     /gene="LINC02620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7919888"
     variation       879
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917943239"
     variation       883
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383246165"
     variation       886
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990707868"
     variation       888
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773619606"
     variation       889
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770112595"
     variation       894
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907545622"
     variation       900
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576618052"
     variation       906
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203607091"
     variation       910..911
                     /gene="LINC02620"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1254493699"
     variation       915
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481124000"
     variation       920
                     /gene="LINC02620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:979716531"
     variation       921..922
                     /gene="LINC02620"
                     /replace=""
                     /replace="tga"
                     /db_xref="dbSNP:1425664136"
     variation       921
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762072506"
     variation       922
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576069997"
     variation       925..926
                     /gene="LINC02620"
                     /replace="ag"
                     /replace="agtagctactcagctactcaag"
                     /db_xref="dbSNP:1389606956"
     variation       927
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930274714"
     variation       931..932
                     /gene="LINC02620"
                     /replace="gc"
                     /replace="gcgc"
                     /db_xref="dbSNP:548346959"
     variation       938
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920884703"
     variation       942
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354902686"
     variation       944
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890766184"
     variation       948
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027956911"
     variation       949
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452882252"
     variation       950
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996348308"
     variation       951
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556820005"
     variation       952
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900752047"
     variation       952
                     /gene="LINC02620"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1275648557"
     variation       956
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308466710"
     variation       957
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209801088"
     variation       960
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236051072"
     variation       961
                     /gene="LINC02620"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964881341"
     variation       963
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1184425582"
     variation       973
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368823001"
     variation       997
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942226795"
     variation       998
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:539791229"
     variation       1007
                     /gene="LINC02620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1420081411"
     variation       1011
                     /gene="LINC02620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047866110"
     variation       1013
                     /gene="LINC02620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243001703"
ORIGIN      
ggttgccaaatggtgttttgggctcttcttttcccaagaagagactagcccattgtcaccaatgcagagctggaagctgaaattgttaaggcagaatgaaagggagaaaagcacgtcctgagcaccaagaagaagataactcgaagttaagaagacgtgatggtactttggagaagaaagcaacacctgagtcaaattgcactgagcaacgttctttgttgttgtgagatattgataaatctccaggtcttcaacaaggggagtcgagaataggaaactcatttcaaatcatatctcaggtgacaagaaggttaccatatttgaggcagcctgttgggttgcctgacggcgaaaatctacagaacattctgccttacattgctggagactgtctcctacaacttgagtctttgatactggtgtcactttcaggagctctaagaatacgtcaactctcgcttctgagttggtgacccctcaaccaagaaaggacggtgatctcattcctctcagcaggagtgttgagctcagacaactatgaaaaccaaaaatcatcccaggtaggttataagggattgaagagaaccagagagtggctcattcataggaagaagctgtgatttggcaccatgtgagcgtcgtcagagataaatgaagatccaacactgccagagctttcaaatctccaagagaagcattcaacctgaattggtatgtgaaatgtctcagtttttaaaagttgacaaccaaatcagaaaataattttaaacaccatgtaggcccaatgaaacacatctccaagccagatccaaatcacagaattccaatcacaggttgaaatccacttctctaaaatcttttcgtctctgaccgggcatggtggcacacgtctgtagtcccagctactcaggaggccaaggtaggagaattgcttgagccctggagttcgacgctagcctgggcaacacagcacgactcagtctctaaaagtaaaaataaaatattttctccaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]