GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:11:37, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_117100               1561 bp    RNA     linear   PRI 18-MAY-2018
DEFINITION  Homo sapiens cancer susceptibility 8 (CASC8), transcript variant 1,
            long non-coding RNA.
ACCESSION   NR_117100
VERSION     NR_117100.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1561)
  AUTHORS   Haerian MS, Haerian BS, Molanaei S, Kosari F, Sabeti S,
            Bidari-Zerehpoosh F and Abdolali E.
  TITLE     Lack of association of CASC8 rs1447295 with colorectal cancer in
            Iranian population: A multicenter case-control study
  JOURNAL   Gene 634, 74-76 (2017)
   PUBMED   28887158
  REMARK    GeneRIF: Results show no association of CASC8 rs1447295 with
            colorectal cancer in Iranian population.
REFERENCE   2  (bases 1 to 1561)
  AUTHORS   Hu R, Zhong P, Xiong L and Duan L.
  TITLE     Long Noncoding RNA Cancer Susceptibility Candidate 8 Suppresses the
            Proliferation of Bladder Cancer Cells via Regulating Glycolysis
  JOURNAL   DNA Cell Biol. 36 (9), 767-774 (2017)
   PUBMED   28759252
  REMARK    GeneRIF: CASC8 reduced the glycolysis of bladder cancer cells via
            interacting with the fibroblast growth factor receptor 1.
REFERENCE   3  (bases 1 to 1561)
  AUTHORS   Hu L, Chen SH, Lv QL, Sun B, Qu Q, Qin CZ, Fan L, Guo Y, Cheng L
            and Zhou HH.
  TITLE     Clinical Significance of Long Non-Coding RNA CASC8 rs10505477
            Polymorphism in Lung Cancer Susceptibility, Platinum-Based
            Chemotherapy Response, and Toxicity
  JOURNAL   Int J Environ Res Public Health 13 (6), E545 (2016)
   PUBMED   27249003
  REMARK    GeneRIF: study showed that lncRNA CASC8 rs10505477 polymorphism was
            significantly related to lung cancer susceptibility and overall
            severe toxicity induced by platinum-based chemotherapy in lung
            cancers.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1561)
  AUTHORS   Yao K, Hua L, Wei L, Meng J and Hu J.
  TITLE     Correlation Between CASC8, SMAD7 Polymorphisms and the
            Susceptibility to Colorectal Cancer: An Updated Meta-Analysis Based
            on GWAS Results
  JOURNAL   Medicine (Baltimore) 94 (46), e1884 (2015)
   PUBMED   26579801
  REMARK    GeneRIF: Meta-analysis suggested that for CASC8 gene, SNP of
            rs7837328 and rs6983267 are risk factors for colorectal cancer
            among both Caucasians and Asians whereas rs7014346 and rs10505477
            are risky gene polymorphisms only among Caucasians.
REFERENCE   5  (bases 1 to 1561)
  AUTHORS   Ma G, Gu D, Lv C, Chu H, Xu Z, Tong N, Wang M, Tang C, Xu Y, Zhang
            Z, Wang B and Chen J.
  TITLE     Genetic variant in 8q24 is associated with prognosis for gastric
            cancer in a Chinese population
  JOURNAL   J. Gastroenterol. Hepatol. 30 (4), 689-695 (2015)
   PUBMED   25302443
REFERENCE   6  (bases 1 to 1561)
  AUTHORS   Gudmundsson J, Sulem P, Gudbjartsson DF, Blondal T, Gylfason A,
            Agnarsson BA, Benediktsdottir KR, Magnusdottir DN, Orlygsdottir G,
            Jakobsdottir M, Stacey SN, Sigurdsson A, Wahlfors T, Tammela T,
            Breyer JP, McReynolds KM, Bradley KM, Saez B, Godino J, Navarrete
            S, Fuertes F, Murillo L, Polo E, Aben KK, van Oort IM, Suarez BK,
            Helfand BT, Kan D, Zanon C, Frigge ML, Kristjansson K, Gulcher JR,
            Einarsson GV, Jonsson E, Catalona WJ, Mayordomo JI, Kiemeney LA,
            Smith JR, Schleutker J, Barkardottir RB, Kong A, Thorsteinsdottir
            U, Rafnar T and Stefansson K.
  TITLE     Genome-wide association and replication studies identify four
            variants associated with prostate cancer susceptibility
  JOURNAL   Nat. Genet. 41 (10), 1122-1126 (2009)
   PUBMED   19767754
REFERENCE   7  (bases 1 to 1561)
  AUTHORS   Tenesa A, Farrington SM, Prendergast JG, Porteous ME, Walker M, Haq
            N, Barnetson RA, Theodoratou E, Cetnarskyj R, Cartwright N, Semple
            C, Clark AJ, Reid FJ, Smith LA, Kavoussanakis K, Koessler T,
            Pharoah PD, Buch S, Schafmayer C, Tepel J, Schreiber S, Volzke H,
            Schmidt CO, Hampe J, Chang-Claude J, Hoffmeister M, Brenner H,
            Wilkening S, Canzian F, Capella G, Moreno V, Deary IJ, Starr JM,
            Tomlinson IP, Kemp Z, Howarth K, Carvajal-Carmona L, Webb E,
            Broderick P, Vijayakrishnan J, Houlston RS, Rennert G, Ballinger D,
            Rozek L, Gruber SB, Matsuda K, Kidokoro T, Nakamura Y, Zanke BW,
            Greenwood CM, Rangrej J, Kustra R, Montpetit A, Hudson TJ,
            Gallinger S, Campbell H and Dunlop MG.
  TITLE     Genome-wide association scan identifies a colorectal cancer
            susceptibility locus on 11q23 and replicates risk loci at 8q24 and
            18q21
  JOURNAL   Nat. Genet. 40 (5), 631-637 (2008)
   PUBMED   18372901
REFERENCE   8  (bases 1 to 1561)
  AUTHORS   Gudmundsson J, Sulem P, Manolescu A, Amundadottir LT, Gudbjartsson
            D, Helgason A, Rafnar T, Bergthorsson JT, Agnarsson BA, Baker A,
            Sigurdsson A, Benediktsdottir KR, Jakobsdottir M, Xu J, Blondal T,
            Kostic J, Sun J, Ghosh S, Stacey SN, Mouy M, Saemundsdottir J,
            Backman VM, Kristjansson K, Tres A, Partin AW, Albers-Akkers MT,
            Godino-Ivan Marcos J, Walsh PC, Swinkels DW, Navarrete S, Isaacs
            SD, Aben KK, Graif T, Cashy J, Ruiz-Echarri M, Wiley KE, Suarez BK,
            Witjes JA, Frigge M, Ober C, Jonsson E, Einarsson GV, Mayordomo JI,
            Kiemeney LA, Isaacs WB, Catalona WJ, Barkardottir RB, Gulcher JR,
            Thorsteinsdottir U, Kong A and Stefansson K.
  TITLE     Genome-wide association study identifies a second prostate cancer
            susceptibility variant at 8q24
  JOURNAL   Nat. Genet. 39 (5), 631-637 (2007)
   PUBMED   17401366
REFERENCE   9  (bases 1 to 1561)
  AUTHORS   Yeager M, Orr N, Hayes RB, Jacobs KB, Kraft P, Wacholder S,
            Minichiello MJ, Fearnhead P, Yu K, Chatterjee N, Wang Z, Welch R,
            Staats BJ, Calle EE, Feigelson HS, Thun MJ, Rodriguez C, Albanes D,
            Virtamo J, Weinstein S, Schumacher FR, Giovannucci E, Willett WC,
            Cancel-Tassin G, Cussenot O, Valeri A, Andriole GL, Gelmann EP,
            Tucker M, Gerhard DS, Fraumeni JF Jr, Hoover R, Hunter DJ, Chanock
            SJ and Thomas G.
  TITLE     Genome-wide association study of prostate cancer identifies a
            second risk locus at 8q24
  JOURNAL   Nat. Genet. 39 (5), 645-649 (2007)
   PUBMED   17401363
REFERENCE   10 (bases 1 to 1561)
  AUTHORS   Amundadottir LT, Sulem P, Gudmundsson J, Helgason A, Baker A,
            Agnarsson BA, Sigurdsson A, Benediktsdottir KR, Cazier JB, Sainz J,
            Jakobsdottir M, Kostic J, Magnusdottir DN, Ghosh S, Agnarsson K,
            Birgisdottir B, Le Roux L, Olafsdottir A, Blondal T, Andresdottir
            M, Gretarsdottir OS, Bergthorsson JT, Gudbjartsson D, Gylfason A,
            Thorleifsson G, Manolescu A, Kristjansson K, Geirsson G, Isaksson
            H, Douglas J, Johansson JE, Balter K, Wiklund F, Montie JE, Yu X,
            Suarez BK, Ober C, Cooney KA, Gronberg H, Catalona WJ, Einarsson
            GV, Barkardottir RB, Gulcher JR, Kong A, Thorsteinsdottir U and
            Stefansson K.
  TITLE     A common variant associated with prostate cancer in European and
            African populations
  JOURNAL   Nat. Genet. 38 (6), 652-658 (2006)
   PUBMED   16682969
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC016883.14 and AC018714.4.
            
            Transcript Variant: This variant (1) represents the longer
            transcript.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMEA1968540,
                              SAMEA1968968 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-506               AC016883.14        166280-166785       c
            507-850             AC016883.14        165374-165717       c
            851-953             AC016883.14        164350-164452       c
            954-1041            AC016883.14        163729-163816       c
            1042-1176           AC016883.14        105475-105609       c
            1177-1561           AC018714.4         57436-57820         c
FEATURES             Location/Qualifiers
     source          1..1561
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q24.21"
     gene            1..1561
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /note="cancer susceptibility 8"
                     /db_xref="GeneID:727677"
                     /db_xref="HGNC:HGNC:45129"
                     /db_xref="MIM:617701"
     ncRNA           1..1561
                     /ncRNA_class="lncRNA"
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /product="cancer susceptibility 8, transcript variant 1"
                     /db_xref="GeneID:727677"
                     /db_xref="HGNC:HGNC:45129"
                     /db_xref="MIM:617701"
     exon            1..506
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       5
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:80339277"
     variation       8
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949719812"
     variation       10
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474987936"
     variation       11
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916898038"
     variation       15..17
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:774653348"
     variation       24
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195277114"
     variation       25
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546402673"
     variation       34
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478068478"
     variation       47
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1010718641"
     variation       48
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891909431"
     variation       53
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390796379"
     variation       55
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991262844"
     variation       60
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033112853"
     variation       61
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1239508243"
     variation       62
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000338849"
     variation       66
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889997173"
     variation       67
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:533030848"
     variation       69
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201812878"
     variation       72
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541951671"
     variation       76
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483853668"
     variation       80
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750558309"
     variation       86..87
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:998484023"
     variation       92
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796255171"
     variation       94
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421187907"
     variation       98
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183375980"
     variation       101
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428111717"
     variation       107
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920477768"
     variation       108
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1479273367"
     variation       117
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:973646594"
     variation       125
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961869852"
     variation       126
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292351922"
     variation       127
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1429447372"
     variation       130
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040065706"
     variation       131
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1210612987"
     variation       132
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014807804"
     variation       136
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391709563"
     variation       144
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765211591"
     variation       157
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907642447"
     variation       165
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285260078"
     variation       173
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252670616"
     variation       174
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339176723"
     variation       188
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550663529"
     variation       190
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226798095"
     variation       196
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048885472"
     variation       220
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535969894"
     variation       225
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481923097"
     variation       230
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1206270315"
     variation       231..234
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1268682685"
     variation       237
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1489711648"
     variation       248
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008744651"
     variation       254
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954739645"
     variation       260
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283194998"
     variation       268
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402600430"
     variation       270
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:927142260"
     variation       274
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9643224"
     variation       276
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77820992"
     variation       289
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430377960"
     variation       295
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363549620"
     variation       296
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917224916"
     variation       322
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988842910"
     variation       328
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408968760"
     variation       334
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1368594940"
     variation       338
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381673651"
     variation       339
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293569398"
     variation       342..345
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="tctt"
                     /db_xref="dbSNP:1309754026"
     variation       346
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229857161"
     variation       351
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291496212"
     variation       354
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191080683"
     variation       360
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357655810"
     variation       363
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759597626"
     variation       367
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187805471"
     variation       375
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485358851"
     variation       376
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956101389"
     variation       378
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053843234"
     variation       381
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764451754"
     variation       384
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426258592"
     variation       394
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:954206332"
     variation       402
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79306777"
     variation       406
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1453376205"
     variation       417
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479511971"
     variation       419
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248490446"
     variation       422
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199862609"
     variation       433
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435909738"
     variation       437
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314891490"
     variation       442
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546421438"
     variation       444
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381253510"
     variation       446..449
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:998828301"
     variation       449
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1248571430"
     variation       451
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577571575"
     variation       452
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046703095"
     variation       453
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248665998"
     variation       454
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949600976"
     variation       459
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464906327"
     variation       461
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200985282"
     variation       464
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76022738"
     variation       467
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886153433"
     variation       470
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055863932"
     variation       475
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446409236"
     variation       476
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78312141"
     variation       481
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930418737"
     variation       482..494
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="gagagagagag"
                     /replace="gagagagagagag"
                     /db_xref="dbSNP:1274855222"
     variation       486
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157105529"
     variation       488
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391124163"
     variation       490
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="ggg"
                     /db_xref="dbSNP:1336197682"
     variation       490
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146701301"
     variation       491
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973147011"
     variation       492
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1450880744"
     variation       495
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285144048"
     variation       503
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373144662"
     exon            507..850
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       522
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:982960951"
     variation       529
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779117526"
     variation       530
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427855937"
     variation       533
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034364789"
     variation       536
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186668435"
     variation       538
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:952915360"
     variation       540
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027243687"
     variation       542
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162662771"
     variation       543
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459580013"
     variation       555
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995755432"
     variation       557
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349545554"
     variation       562
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898861285"
     variation       565
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037368986"
     variation       567
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940322627"
     variation       573
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391452100"
     variation       578
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381711109"
     variation       588..589
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1296114247"
     variation       590
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:544076389"
     variation       591
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886198348"
     variation       594
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229649635"
     variation       597
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426464415"
     variation       600
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1051434240"
     variation       604
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265660136"
     variation       610
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485292409"
     variation       613
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206258633"
     variation       617
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249862436"
     variation       618
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171978508"
     variation       619
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449960129"
     variation       620
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933175263"
     variation       624
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:575045095"
     variation       625
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561695653"
     variation       632
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374232100"
     variation       636
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975096288"
     variation       644
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760998528"
     variation       645
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925313393"
     variation       646..655
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aataaa"
                     /replace="aataaataaa"
                     /db_xref="dbSNP:1192572929"
     variation       657
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488568855"
     variation       660
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231940863"
     variation       666
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978087677"
     variation       667
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436390761"
     variation       670
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042945411"
     variation       677
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997203564"
     variation       681
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966666031"
     variation       689
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1025076550"
     variation       692..694
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1226072438"
     variation       694
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315926564"
     variation       696
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992219450"
     variation       711
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944107786"
     variation       717
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202877449"
     variation       718
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541464998"
     variation       722
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565227865"
     variation       725
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182205959"
     variation       729
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572566010"
     variation       737
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414842737"
     variation       739
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472360569"
     variation       743
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754077566"
     variation       744
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414194164"
     variation       749
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2290033"
     variation       751
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185811100"
     variation       754
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176051040"
     variation       769
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357905672"
     variation       774
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004518906"
     variation       780
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368659156"
     variation       782
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:576606714"
     variation       785
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920126887"
     variation       793
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:981017381"
     variation       798
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74466606"
     variation       799
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051485154"
     variation       813
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537318112"
     variation       814
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313845283"
     variation       816
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332662867"
     variation       820
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377622271"
     variation       823
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:568287595"
     variation       827
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900364912"
     variation       833
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1469676710"
     variation       834
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038861032"
     exon            851..953
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       854
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902739530"
     variation       857
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043947953"
     variation       864
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280734955"
     variation       868
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887202214"
     variation       869
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567746855"
     variation       873
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7831028"
     variation       877
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534196661"
     variation       878
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922757011"
     variation       887
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550701062"
     variation       891
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332532742"
     variation       900
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763520560"
     variation       901
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912334411"
     variation       903
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050878258"
     variation       923
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203131880"
     variation       930
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234608294"
     variation       936
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323775278"
     variation       942
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550722779"
     variation       943
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929804927"
     variation       945
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:910257535"
     variation       951
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148344941"
     variation       953
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973965657"
     exon            954..1041
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       959
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025477513"
     variation       962
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358912873"
     variation       968
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976729276"
     variation       975
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1465064397"
     variation       976
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895005246"
     variation       977
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75035821"
     variation       982
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018798813"
     variation       985
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371525508"
     variation       988..990
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1463617033"
     variation       1004
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168517320"
     variation       1007
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927956767"
     variation       1009
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978076930"
     variation       1010
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:528798665"
     variation       1012
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904722353"
     variation       1017
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879098243"
     variation       1019
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372254409"
     variation       1021
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114475594"
     variation       1024..1026
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1474092066"
     variation       1024
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180629864"
     variation       1027
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308846027"
     variation       1032
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227540446"
     variation       1034..1040
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1215551052"
     variation       1035
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264280961"
     exon            1042..1176
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       1043
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1324942752"
     variation       1045
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392066282"
     variation       1050
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770996009"
     variation       1060
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563685711"
     variation       1073
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185560031"
     variation       1076
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325287391"
     variation       1077
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271490539"
     variation       1086
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79190213"
     variation       1087
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002507451"
     variation       1103
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563685698"
     variation       1110
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272899250"
     variation       1111
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184974351"
     variation       1113
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486942503"
     variation       1120
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446996884"
     variation       1123
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191092618"
     variation       1126
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243083721"
     variation       1127
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222120704"
     variation       1136
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749724207"
     variation       1149
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478250188"
     variation       1153
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964391290"
     variation       1154..1155
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="tattttggactgacgta"
                     /db_xref="dbSNP:1415324272"
     variation       1155
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1563685684"
     variation       1157
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1358003691"
     variation       1158
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1294589133"
     variation       1160
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246130895"
     variation       1163
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140159894"
     variation       1176
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006564230"
     exon            1177..1561
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       1187
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537819876"
     variation       1191
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563649379"
     variation       1192
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013899023"
     variation       1201
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210562076"
     variation       1202
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143019371"
     variation       1207
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199210981"
     variation       1208
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902529689"
     variation       1213
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054872620"
     variation       1216
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148177806"
     variation       1230
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460699169"
     variation       1237
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1563649366"
     variation       1238
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898585969"
     variation       1239
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199278733"
     variation       1242
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037487307"
     variation       1243
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254084369"
     variation       1245
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940129455"
     variation       1272
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540991016"
     variation       1273
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177229841"
     variation       1276
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372936533"
     variation       1279
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986836758"
     variation       1286
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300170364"
     variation       1287
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371184809"
     variation       1288
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404441593"
     variation       1299
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302282180"
     variation       1302
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223245100"
     variation       1307
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374781338"
     variation       1308
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114244916"
     variation       1310
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294578016"
     variation       1311
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210187100"
     variation       1313
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:921541494"
     variation       1324
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405794567"
     variation       1325
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143761001"
     variation       1328
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745393412"
     variation       1329
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358021950"
     variation       1335
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:796321512"
     variation       1337
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031841438"
     variation       1338..1368
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="agctg"
                     /replace="agctgatgccacatgaagcagacacaagctg"
                     /db_xref="dbSNP:1437218342"
     variation       1338
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270486420"
     variation       1340
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978209948"
     variation       1341
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966505900"
     variation       1351
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944934874"
     variation       1360
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192329635"
     variation       1363
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35132843"
     variation       1365
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157950000"
     variation       1370
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1381633793"
     variation       1374
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1170678193"
     variation       1379
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179162222"
     variation       1381
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1391027544"
     variation       1384
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424036540"
     variation       1394
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047977558"
     variation       1395
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563649308"
     variation       1404
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013234793"
     variation       1413
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437070556"
     variation       1415
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:546762735"
     variation       1419
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770529614"
     variation       1420
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918253732"
     variation       1424
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383711150"
     variation       1428
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033599300"
     variation       1429..1437
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="taatt"
                     /replace="taattaatt"
                     /db_xref="dbSNP:1358268231"
     variation       1443..1445
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="gtg"
                     /db_xref="dbSNP:1201920767"
     variation       1445
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995387944"
     variation       1453
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:898301620"
     variation       1454
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036881409"
     variation       1460
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1321844390"
     variation       1463
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222885976"
     variation       1474
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483466971"
     variation       1486
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351097746"
     variation       1495
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533024017"
     variation       1496
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190928430"
     variation       1503
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:569757435"
     variation       1519..1525
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1351593489"
     variation       1521
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940076124"
     variation       1523
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1249100990"
     variation       1528
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444234192"
     variation       1537..1546
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="ttg"
                     /replace="ttgatgtttg"
                     /db_xref="dbSNP:1311634586"
     variation       1537..1538
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1182023327"
     variation       1541
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973729598"
     variation       1560
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406050135"
ORIGIN      
tgaaccaccccaggccctttgcacctgctattccctctcctcagcatgctctgccccagacaattgcaatgctaacttcttacttccttcaggtttcactcagaaatgactttctcagtggggtctcccatgaccattttatttaagatttcaactactttgccagtatttcacttctcctcccttgatcttttcttccaagcactcactgccctcttgcacactgtatcttttacttatttatcttgttcagtttctgcctgcctcacctgcctcaccacagtgtacatttcacgagggcagggattttgtctgttttgttgattgctgtagccctggcatcttgggcagtgccagcacctgttagcattaaatacatatttactgaatgaatgagtggcttcatgcttaaaagcaagaagagagaccttcatagagaagtaggaaaatgaattgttgcacaaataaagggccatgtaatgagagagagagagcaagagaaagagcaaacaattaaggagcagcagtggcttcctgcaggggagaccaatgccttctgtcctcagcggaaacagcttggcattcttccaattgatgaatggcatggaccaggagcactagttatcttcagcttctgagcatccgaataaataaacatacaaatgcataacataaaataaattcaaattacaaatgagaaaaccaatctaggttaccggcaagtcctatgacttgatgtggaggcctggaagtgcatccttgaatcttgcaatgcagtgagccaaggagcaatgagaggccacatgaataaccgggccagtgacaagacacatgtcctcctccttgctggtatacaccagaatgccccgcatgcagcgaatgctcaaaaagtgttggtggaagtgacagaattccatcaccattaaacacaaccagtgttgcggttgacaatggcactgaagcaggtgaaaaatccgtacagcagcttctgtctttgaagagtttgcagcctcttgaagagggtttagaggttaaaaaaagctttgtgctgatgaacatggtcaccttgaaaggtgtgttgaatatggcagagccagaaaatgcaaggagcttcttctctggatcaccacttgaagaagagccacttgctcctcaggaaccctattttggactgacgttgcaagaaagctcaagtagcctatggagaggatgcaaggcttccagctgatgccctcagccaggctcagtagcagccagaactagcctaccaacgaacctgctgatcatgtgcataagccaccttgaacgtcgatcctcctgcctggtggagccatcccagctgatgccacatgaagcagacacaagctgtccctactaagctctgctcaagttggatattcatgagtgaaataaatgactgttactaagtaattaatttttgggtggctgttatgtagcagtagataattggaacaaagcttattgacataatacatctatatcacatcctccaatccatttttttaagtaataaagttgatgtttgttttgattttcagtt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]