GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:43:36, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_110999                775 bp    RNA     linear   PRI 04-DEC-2018
DEFINITION  Homo sapiens family with sequence similarity 74 member A6
            (FAM74A6), long non-coding RNA.
ACCESSION   NR_110999
VERSION     NR_110999.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL590491.13.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC121813.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-614               AL590491.13        100261-100874
            615-698             AL590491.13        105718-105801
            699-775             AL590491.13        106130-106206
FEATURES             Location/Qualifiers
     source          1..775
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="9"
                     /map="9q12"
     gene            1..775
                     /gene="FAM74A6"
                     /note="family with sequence similarity 74 member A6"
                     /db_xref="GeneID:653123"
                     /db_xref="HGNC:HGNC:34036"
     ncRNA           1..775
                     /ncRNA_class="lncRNA"
                     /gene="FAM74A6"
                     /product="family with sequence similarity 74 member A6"
                     /db_xref="GeneID:653123"
                     /db_xref="HGNC:HGNC:34036"
     exon            1..614
                     /gene="FAM74A6"
                     /inference="alignment:Splign:2.1.0"
     variation       171
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554802910"
     variation       179
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554802911"
     variation       213
                     /gene="FAM74A6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554802913"
     variation       216
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554802914"
     variation       226
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554802915"
     variation       227
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554802916"
     variation       283
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554802917"
     variation       308
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554802918"
     variation       580
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1198117963"
     variation       588
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312935331"
     variation       608
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554802919"
     exon            615..698
                     /gene="FAM74A6"
                     /inference="alignment:Splign:2.1.0"
     exon            699..775
                     /gene="FAM74A6"
                     /inference="alignment:Splign:2.1.0"
     variation       699
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352403093"
     variation       719
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327258929"
     variation       722
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376565944"
     variation       731
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176121678"
     variation       741
                     /gene="FAM74A6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453150168"
     variation       753
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394504436"
     variation       754
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177866230"
     variation       756
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331095148"
     variation       764
                     /gene="FAM74A6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471244012"
     variation       765
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231462303"
     variation       768
                     /gene="FAM74A6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1203542479"
ORIGIN      
cagggtagggctccagctaagccacgtaggcactacgatgggcaacagaaaggttggtttctgggcaattcagagaaaccaaggacagctacccccagaactcagagtagccaactgggctgctcacaggagatgccttaactgaaaggtgatcagactccacaggagacccagagaagatgtggagggagctcagaggctgtcctggaggagacgtggagacagctcagaggctgtcccagagaagacgtggaaagagctcagaggctgtcccagagaagacgtggagagctcagaggatgtcccagagaagacgtggagagagttcagaggctgtcccggagaagacgtggaaagagctcagaaactcagagactgtcccggagaagacatggaaacagctcagaggctgtctgcaagaagacgtgcagagagttcagaggctgtcccggagaagacatggagagagctcaaaggctgtccacaagaagatgtggagagagttcagaggctgtcgttactgctgcacttggctgtttttctttggataattattgcaatcaattttagtaattcaggtgttaaatcacagtcaagcacctatttacctagtgtggtctgatgaatttcacttctttgatactttttgagagagctgagagtccatttcctgaggaagaaactcagagaaaacaaatgtaaaatccttaagtaagtcatatttggttgggaagatcaaagaaatcacccagtctcccacatccgaaattgtgca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]