GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:34:54, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_110883                558 bp    RNA     linear   PRI 04-DEC-2018
DEFINITION  Homo sapiens uncharacterized LOC102724596 (LOC102724596),
            transcript variant 2, long non-coding RNA.
ACCESSION   NR_110883
VERSION     NR_110883.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 558)
  AUTHORS   Coviello AD, Haring R, Wellons M, Vaidya D, Lehtimaki T, Keildson
            S, Lunetta KL, He C, Fornage M, Lagou V, Mangino M, Onland-Moret
            NC, Chen B, Eriksson J, Garcia M, Liu YM, Koster A, Lohman K,
            Lyytikainen LP, Petersen AK, Prescott J, Stolk L, Vandenput L, Wood
            AR, Zhuang WV, Ruokonen A, Hartikainen AL, Pouta A, Bandinelli S,
            Biffar R, Brabant G, Cox DG, Chen Y, Cummings S, Ferrucci L, Gunter
            MJ, Hankinson SE, Martikainen H, Hofman A, Homuth G, Illig T,
            Jansson JO, Johnson AD, Karasik D, Karlsson M, Kettunen J, Kiel DP,
            Kraft P, Liu J, Ljunggren O, Lorentzon M, Maggio M, Markus MR,
            Mellstrom D, Miljkovic I, Mirel D, Nelson S, Morin Papunen L,
            Peeters PH, Prokopenko I, Raffel L, Reincke M, Reiner AP, Rexrode
            K, Rivadeneira F, Schwartz SM, Siscovick D, Soranzo N, Stockl D,
            Tworoger S, Uitterlinden AG, van Gils CH, Vasan RS, Wichmann HE,
            Zhai G, Bhasin S, Bidlingmaier M, Chanock SJ, De Vivo I, Harris TB,
            Hunter DJ, Kahonen M, Liu S, Ouyang P, Spector TD, van der Schouw
            YT, Viikari J, Wallaschofski H, McCarthy MI, Frayling TM, Murray A,
            Franks S, Jarvelin MR, de Jong FH, Raitakari O, Teumer A, Ohlsson
            C, Murabito JM and Perry JR.
  TITLE     A genome-wide association meta-analysis of circulating sex
            hormone-binding globulin reveals multiple Loci implicated in sex
            steroid hormone regulation
  JOURNAL   PLoS Genet. 8 (7), e1002805 (2012)
   PUBMED   22829776
REFERENCE   2  (bases 1 to 558)
  AUTHORS   Haiman CA, Chen GK, Blot WJ, Strom SS, Berndt SI, Kittles RA,
            Rybicki BA, Isaacs WB, Ingles SA, Stanford JL, Diver WR, Witte JS,
            Hsing AW, Nemesure B, Rebbeck TR, Cooney KA, Xu J, Kibel AS, Hu JJ,
            John EM, Gueye SM, Watya S, Signorello LB, Hayes RB, Wang Z, Yeboah
            E, Tettey Y, Cai Q, Kolb S, Ostrander EA, Zeigler-Johnson C,
            Yamamura Y, Neslund-Dudas C, Haslag-Minoff J, Wu W, Thomas V, Allen
            GO, Murphy A, Chang BL, Zheng SL, Leske MC, Wu SY, Ray AM, Hennis
            AJ, Thun MJ, Carpten J, Casey G, Carter EN, Duarte ER, Xia LY,
            Sheng X, Wan P, Pooler LC, Cheng I, Monroe KR, Schumacher F, Le
            Marchand L, Kolonel LN, Chanock SJ, Van Den Berg D, Stram DO and
            Henderson BE.
  TITLE     Genome-wide association study of prostate cancer in men of African
            ancestry identifies a susceptibility locus at 17q21
  JOURNAL   Nat. Genet. 43 (6), 570-573 (2011)
   PUBMED   21602798
REFERENCE   3  (bases 1 to 558)
  AUTHORS   Newton-Cheh C, Johnson T, Gateva V, Tobin MD, Bochud M, Coin L,
            Najjar SS, Zhao JH, Heath SC, Eyheramendy S, Papadakis K, Voight
            BF, Scott LJ, Zhang F, Farrall M, Tanaka T, Wallace C, Chambers JC,
            Khaw KT, Nilsson P, van der Harst P, Polidoro S, Grobbee DE,
            Onland-Moret NC, Bots ML, Wain LV, Elliott KS, Teumer A, Luan J,
            Lucas G, Kuusisto J, Burton PR, Hadley D, McArdle WL, Brown M,
            Dominiczak A, Newhouse SJ, Samani NJ, Webster J, Zeggini E,
            Beckmann JS, Bergmann S, Lim N, Song K, Vollenweider P, Waeber G,
            Waterworth DM, Yuan X, Groop L, Orho-Melander M, Allione A, Di
            Gregorio A, Guarrera S, Panico S, Ricceri F, Romanazzi V, Sacerdote
            C, Vineis P, Barroso I, Sandhu MS, Luben RN, Crawford GJ,
            Jousilahti P, Perola M, Boehnke M, Bonnycastle LL, Collins FS,
            Jackson AU, Mohlke KL, Stringham HM, Valle TT, Willer CJ, Bergman
            RN, Morken MA, Doring A, Gieger C, Illig T, Meitinger T, Org E,
            Pfeufer A, Wichmann HE, Kathiresan S, Marrugat J, O'Donnell CJ,
            Schwartz SM, Siscovick DS, Subirana I, Freimer NB, Hartikainen AL,
            McCarthy MI, O'Reilly PF, Peltonen L, Pouta A, de Jong PE, Snieder
            H, van Gilst WH, Clarke R, Goel A, Hamsten A, Peden JF, Seedorf U,
            Syvanen AC, Tognoni G, Lakatta EG, Sanna S, Scheet P, Schlessinger
            D, Scuteri A, Dorr M, Ernst F, Felix SB, Homuth G, Lorbeer R,
            Reffelmann T, Rettig R, Volker U, Galan P, Gut IG, Hercberg S,
            Lathrop GM, Zelenika D, Deloukas P, Soranzo N, Williams FM, Zhai G,
            Salomaa V, Laakso M, Elosua R, Forouhi NG, Volzke H, Uiterwaal CS,
            van der Schouw YT, Numans ME, Matullo G, Navis G, Berglund G,
            Bingham SA, Kooner JS, Connell JM, Bandinelli S, Ferrucci L,
            Watkins H, Spector TD, Tuomilehto J, Altshuler D, Strachan DP, Laan
            M, Meneton P, Wareham NJ, Uda M, Jarvelin MR, Mooser V, Melander O,
            Loos RJ, Elliott P, Abecasis GR, Caulfield M and Munroe PB.
  CONSRTM   Wellcome Trust Case Control Consortium
  TITLE     Genome-wide association study identifies eight loci associated with
            blood pressure
  JOURNAL   Nat. Genet. 41 (6), 666-676 (2009)
   PUBMED   19430483
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC091180.20.
            
            Transcript Variant: This variant (2) contains multiple differences
            at both the 5' and 3' ends, resulting in a shorter transcript,
            compared to variant 1.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR3476690.116507.1,
                                           SRR1803617.421143.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-30                AC091180.20        68456-68485
            31-101              AC091180.20        71365-71435
            102-243             AC091180.20        80099-80240
            244-443             AC091180.20        82396-82595
            444-558             AC091180.20        87066-87180
FEATURES             Location/Qualifiers
     source          1..558
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q21.33"
     gene            1..558
                     /gene="LOC102724596"
                     /note="uncharacterized LOC102724596"
                     /db_xref="GeneID:102724596"
     ncRNA           1..558
                     /ncRNA_class="lncRNA"
                     /gene="LOC102724596"
                     /product="uncharacterized LOC102724596, transcript variant
                     2"
                     /db_xref="GeneID:102724596"
     exon            1..30
                     /gene="LOC102724596"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962267370"
     variation       5
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1289539433"
     variation       6
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:973655301"
     variation       7
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026618302"
     variation       14
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944569705"
     variation       16
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324956019"
     variation       26
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1036281686"
     variation       30
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407086324"
     exon            31..101
                     /gene="LOC102724596"
                     /inference="alignment:Splign:2.1.0"
     variation       34
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1279696726"
     variation       49
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1567706479"
     variation       55
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211909554"
     variation       68
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62076449"
     variation       69
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751691029"
     variation       70
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035667021"
     variation       74
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374703565"
     variation       94
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:956101436"
     variation       95
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281725470"
     variation       96
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1010280011"
     exon            102..243
                     /gene="LOC102724596"
                     /inference="alignment:Splign:2.1.0"
     variation       106
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479587457"
     variation       123
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991575094"
     variation       124
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898121561"
     variation       125
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916981428"
     variation       127
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185097938"
     variation       135
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416752310"
     variation       139
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041521982"
     variation       141
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:567027571"
     variation       146
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774940675"
     variation       149
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115087312"
     variation       150
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1567708383"
     variation       157
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400484225"
     variation       158
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899762382"
     variation       164
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371191468"
     variation       167
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977445387"
     variation       169
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431701685"
     variation       180
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424723577"
     variation       185
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1192199043"
     variation       191
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1567708389"
     variation       216
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923844324"
     variation       221
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250257658"
     variation       227
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182023763"
     variation       228
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956655822"
     variation       230
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989677507"
     variation       237
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:996837243"
     variation       239
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207404411"
     variation       240
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1398905979"
     exon            244..443
                     /gene="LOC102724596"
                     /inference="alignment:Splign:2.1.0"
     variation       244
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220342051"
     variation       245
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359017298"
     variation       247
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537037455"
     variation       248
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193241928"
     variation       250
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887735815"
     variation       251
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760708141"
     variation       254
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003507903"
     variation       255
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181318931"
     variation       258
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558232916"
     variation       259
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1470546014"
     variation       269
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185362744"
     variation       280
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1300750031"
     variation       281
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:905578207"
     variation       290
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989563494"
     variation       292
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388851952"
     variation       293
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570485283"
     variation       296
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035331155"
     variation       297
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:891436552"
     variation       301
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548903225"
     variation       306
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568790729"
     variation       311
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288246693"
     variation       312
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490196857"
     variation       324
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022285641"
     variation       327
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969035838"
     variation       334
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479773152"
     variation       341
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775682957"
     variation       342
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251173368"
     variation       353
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763067178"
     variation       360
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228528263"
     variation       366
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147601241"
     variation       368
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281874759"
     variation       379
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018403597"
     variation       381
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965402107"
     variation       394
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:912107186"
     variation       410
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764438547"
     variation       411
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376487379"
     variation       412
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355229366"
     variation       413
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972321191"
     variation       433
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751868172"
     variation       435
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918702041"
     variation       436
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77764116"
     variation       438
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175673529"
     variation       439
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480711923"
     variation       440
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984179825"
     variation       441
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571326556"
     exon            444..558
                     /gene="LOC102724596"
                     /inference="alignment:Splign:2.1.0"
     variation       457
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916434831"
     variation       458
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221609604"
     variation       460
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441894391"
     variation       473
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949266811"
     variation       486
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273265679"
     variation       491
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223331905"
     variation       494
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305351447"
     variation       495
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531126807"
     variation       497
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1214984246"
     variation       498
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183904679"
     variation       500
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367062333"
     variation       521
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301227289"
     variation       541
                     /gene="LOC102724596"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:961987981"
     variation       544
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981870849"
     variation       548
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:973113925"
     variation       549
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027780304"
     variation       552
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958452501"
     variation       555
                     /gene="LOC102724596"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147788625"
     variation       556
                     /gene="LOC102724596"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917085932"
ORIGIN      
ggtggagaaaggtctgcattacccactggggggatgatgcagcaagaagacccacaccagatgagggcgccttgatattggatttcccagcctccagaactacagagtcttgctctgtcactcgggctggagtacagtgacacaatcacggttcactgcagcctggacctcccaggctcaagtgatccccctgctgcagcctcctgagtagctgggactacaggcctgtgccaccatgtccaggtccggtccactgctaggagatccatatctactctttgggagttctccagaggaaaaaatcaacaggcgggagaaagatactctgctagcttcagattcattagtactaggaaatggagagataggaggtataatgtattagggaagcaagggattcagaaccaggtgcccactgactctgagaagcactgggtgcacagagggtagcagacaagcaagagggtggaatttgcagcatctcatcttggtgagacagttggaagacttttctgccaattatagtggttaaacactgactcaacatcaaacaacggc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]