GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:35:34, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_110733                580 bp    RNA     linear   PRI 12-MAY-2018
DEFINITION  Homo sapiens ZNF649 antisense RNA 1 (ZNF649-AS1), long non-coding
            RNA.
ACCESSION   NR_110733 XR_244010 XR_248587 XR_253903
VERSION     NR_110733.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 580)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DB080180.1 and AI458876.1.
            On or before Feb 25, 2014 this sequence version replaced
            XR_244010.2, XR_248587.2, XR_253903.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DB080180.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148093
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-448               DB080180.1         1-448
            449-579             AI458876.1         5-135               c
            580-580             DB080180.1         580-580
FEATURES             Location/Qualifiers
     source          1..580
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.41"
     gene            1..580
                     /gene="ZNF649-AS1"
                     /note="ZNF649 antisense RNA 1"
                     /db_xref="GeneID:101928571"
                     /db_xref="HGNC:HGNC:51285"
     ncRNA           1..580
                     /ncRNA_class="lncRNA"
                     /gene="ZNF649-AS1"
                     /product="ZNF649 antisense RNA 1"
                     /db_xref="GeneID:101928571"
                     /db_xref="HGNC:HGNC:51285"
     exon            1..102
                     /gene="ZNF649-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       3
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75075099"
     variation       7
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426998091"
     variation       12
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265945574"
     variation       15
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555352692"
     variation       17
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184558993"
     variation       21
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919502084"
     variation       22
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:534736751"
     variation       23
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177236037"
     variation       25
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982656401"
     variation       26
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568453444"
     variation       27
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018306035"
     variation       28
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568453450"
     variation       30
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186742181"
     variation       32
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778295510"
     variation       33
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529437402"
     variation       34
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547984827"
     variation       46..49
                     /gene="ZNF649-AS1"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1290747797"
     variation       62
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938071527"
     variation       64
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337386347"
     variation       66
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1197599004"
     variation       70
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1391985904"
     variation       72
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868821696"
     variation       73
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306446764"
     variation       74
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366643125"
     variation       76
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915269185"
     variation       79
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456868040"
     variation       81..84
                     /gene="ZNF649-AS1"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1470559776"
     variation       82
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988675391"
     variation       86..87
                     /gene="ZNF649-AS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1179222265"
     variation       87
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386819403"
     variation       88
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457105378"
     variation       89
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568453478"
     variation       91
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418044678"
     variation       92
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1289652284"
     variation       93
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364409417"
     variation       97
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1385120965"
     variation       100
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912980630"
     variation       101
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1267928554"
     exon            103..238
                     /gene="ZNF649-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       108
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013323595"
     variation       117
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427335087"
     variation       118..121
                     /gene="ZNF649-AS1"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1267126338"
     variation       122
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568456120"
     variation       124
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868173169"
     variation       132..140
                     /gene="ZNF649-AS1"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:752783031"
     variation       139
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242341734"
     variation       147
                     /gene="ZNF649-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1201525180"
     variation       150
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570992247"
     variation       169
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148926580"
     variation       176
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159148551"
     variation       186
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969076783"
     variation       194
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767697292"
     variation       196
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248497963"
     variation       197
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032559144"
     variation       200
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:956859346"
     variation       201..208
                     /gene="ZNF649-AS1"
                     /replace="gaa"
                     /replace="gaaatgaa"
                     /db_xref="dbSNP:766090643"
     variation       201
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394647033"
     variation       208
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399259416"
     variation       211
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931052386"
     variation       214
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:557115401"
     variation       227
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1299183865"
     variation       238
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461063721"
     exon            239..580
                     /gene="ZNF649-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       239
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543216153"
     variation       248
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754109950"
     variation       255
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762186189"
     variation       256
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055084853"
     variation       258
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199959359"
     variation       264
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114365071"
     variation       265
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758435751"
     variation       271
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766295631"
     variation       286
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540901521"
     variation       288..290
                     /gene="ZNF649-AS1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:991238332"
     variation       288
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254895491"
     variation       298
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206403134"
     variation       301
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886163248"
     variation       304
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194677208"
     variation       311
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769694266"
     variation       315..318
                     /gene="ZNF649-AS1"
                     /replace="tc"
                     /replace="tctc"
                     /db_xref="dbSNP:1194064009"
     variation       322
                     /gene="ZNF649-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1358380465"
     variation       328
                     /gene="ZNF649-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:559578602"
     variation       329
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568457111"
     variation       330
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018988495"
     variation       335
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773346258"
     variation       340
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291705223"
     variation       341
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444602765"
     variation       344
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438893950"
     variation       357
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328597512"
     variation       363..364
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:574837286"
     variation       365
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:527721875"
     variation       373
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165037507"
     variation       378
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475109742"
     variation       379
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1549931"
     variation       380
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1414983439"
     variation       387
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178626272"
     variation       388
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420234846"
     variation       392
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232161381"
     variation       403
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474559418"
     variation       404
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975396031"
     variation       414
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1033245345"
     variation       423
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420384662"
     variation       438
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411566456"
     variation       447
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287791196"
     variation       448
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772046016"
     variation       450
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934970133"
     variation       453
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311033787"
     variation       454
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957520080"
     variation       463
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988910061"
     variation       466
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775230053"
     variation       472
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314504286"
     variation       487
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890633163"
     variation       505
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373867120"
     variation       506
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564467676"
     variation       510..512
                     /gene="ZNF649-AS1"
                     /replace=""
                     /replace="ata"
                     /db_xref="dbSNP:761789466"
     variation       523
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270257838"
     variation       525..527
                     /gene="ZNF649-AS1"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1340924962"
     variation       534
                     /gene="ZNF649-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440792227"
     variation       538
                     /gene="ZNF649-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007645035"
     variation       557..559
                     /gene="ZNF649-AS1"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1160650743"
     variation       558
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400940434"
     variation       559
                     /gene="ZNF649-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406720551"
     variation       564..567
                     /gene="ZNF649-AS1"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1156619334"
     variation       566..572
                     /gene="ZNF649-AS1"
                     /replace="aaca"
                     /replace="aacaaca"
                     /db_xref="dbSNP:1455450390"
ORIGIN      
gatgcaatatgtctgcgcccaggggacgcttgctgggagcagccattttcaaccctactgccgtagagcaggcggagtccctcttttcgcgccttaagacagaaacacaaaatgatcctctgacaagtgatgaagaagaatgggaagatgtgaaaatccaagcaagaagaacttaggggaagcaactcaacatctaagaagaaatgaatagggatcagttccaagaagagataaaggggaaatacccaagaactgggatgcttcgtctttggtttcttctggatcctccctaaattttggctaagaaatctgagtctccatttaagagtgttcccagaaatgatgacatccacatccaggaacctcctccttccttcatttgaactctcttgcttctggggagccaggacctatggagtaaaaatcaagttcatttggtgacacattccctccgggcccagatgctgtctctgctgctgtaaactctcctgcagtcaaggccaagcaatatatctaagcatccctttgtcaggtgtccccaagtctttacatcccagggcaataaaacaacactctgaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]