GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:18:54, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_110547                752 bp    RNA     linear   PRI 04-DEC-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 1500
            (LINC01500), long non-coding RNA.
ACCESSION   NR_110547 XR_424508 XR_429368 XR_432985
VERSION     NR_110547.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 752)
  AUTHORS   Comuzzie AG, Cole SA, Laston SL, Voruganti VS, Haack K, Gibbs RA
            and Butte NF.
  TITLE     Novel genetic loci identified for the pathophysiology of childhood
            obesity in the Hispanic population
  JOURNAL   PLoS ONE 7 (12), e51954 (2012)
   PUBMED   23251661
REFERENCE   2  (bases 1 to 752)
  AUTHORS   Otowa T, Yoshida E, Sugaya N, Yasuda S, Nishimura Y, Inoue K,
            Tochigi M, Umekage T, Miyagawa T, Nishida N, Tokunaga K, Tanii H,
            Sasaki T, Kaiya H and Okazaki Y.
  TITLE     Genome-wide association study of panic disorder in the Japanese
            population
  JOURNAL   J. Hum. Genet. 54 (2), 122-126 (2009)
   PUBMED   19165232
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CR739775.1 and AW102585.1.
            On or before Feb 12, 2014 this sequence version replaced
            XR_424508.1, XR_429368.1, XR_432985.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR5189667.85555.1,
                                           SRR5189667.266345.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148874
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-686               CR739775.1         1-686
            687-752             AW102585.1         3-68                c
FEATURES             Location/Qualifiers
     source          1..752
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q23.1"
     gene            1..752
                     /gene="LINC01500"
                     /note="long intergenic non-protein coding RNA 1500"
                     /db_xref="GeneID:102723742"
                     /db_xref="HGNC:HGNC:51166"
     ncRNA           1..752
                     /ncRNA_class="lncRNA"
                     /gene="LINC01500"
                     /product="long intergenic non-protein coding RNA 1500"
                     /db_xref="GeneID:102723742"
                     /db_xref="HGNC:HGNC:51166"
     exon            1..268
                     /gene="LINC01500"
                     /inference="alignment:Splign:2.1.0"
     variation       3
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1045124831"
     variation       4
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1274585849"
     variation       8
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215306488"
     variation       12
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:926709131"
     variation       14
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563235044"
     variation       16
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356448232"
     variation       17
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293030007"
     variation       25
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413395198"
     variation       26
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364685552"
     variation       28
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213561566"
     variation       29
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054195826"
     variation       30
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892504759"
     variation       34
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343544803"
     variation       41
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1167310955"
     variation       43..48
                     /gene="LINC01500"
                     /replace="atggca"
                     /replace="atggcatggca"
                     /db_xref="dbSNP:1462146076"
     variation       44
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021125813"
     variation       52
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566554247"
     variation       53
                     /gene="LINC01500"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:532743555"
     variation       58
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1209423471"
     variation       59
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967289757"
     variation       60
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003707631"
     variation       61
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770329774"
     variation       74
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186017406"
     variation       75
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484584116"
     variation       83
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991617292"
     variation       88
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:915597925"
     variation       96
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178460786"
     variation       103..104
                     /gene="LINC01500"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1254358477"
     variation       103
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952318131"
     variation       105
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:890941058"
     variation       106
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333701765"
     variation       108
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1405100074"
     variation       113
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1418198288"
     variation       115
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008485016"
     variation       125
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984045423"
     variation       127
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176295179"
     variation       143
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367909190"
     variation       146
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908449876"
     variation       153
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773649936"
     variation       163
                     /gene="LINC01500"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:112747759"
     variation       163
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:995300634"
     variation       168
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549927256"
     variation       172
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040864462"
     variation       173
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922705602"
     variation       182
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444238759"
     variation       185
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571628455"
     variation       190
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:932767046"
     variation       191
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281398118"
     variation       206
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1371240800"
     variation       208
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049778374"
     variation       209
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304417925"
     variation       212
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893813774"
     variation       215
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567771316"
     variation       227
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232555498"
     variation       228
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1042652862"
     variation       230
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538898720"
     variation       231
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918180230"
     variation       232
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547482509"
     variation       242
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970888606"
     variation       245
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190057116"
     variation       246..249
                     /gene="LINC01500"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1396885317"
     variation       247
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193700964"
     variation       249
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182711644"
     variation       251
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566554339"
     variation       267
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766298851"
     exon            269..457
                     /gene="LINC01500"
                     /inference="alignment:Splign:2.1.0"
     variation       270
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446101749"
     variation       274
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536245144"
     variation       275
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985812805"
     variation       276
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2348816"
     variation       279
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:553372787"
     variation       283
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997086239"
     variation       286..287
                     /gene="LINC01500"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:879294994"
     variation       292
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157130420"
     variation       297..311
                     /gene="LINC01500"
                     /replace=""
                     /replace="gttgatggataagtg"
                     /db_xref="dbSNP:1446647108"
     variation       299
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1385678535"
     variation       302
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182748181"
     variation       303
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442772267"
     variation       305
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050462002"
     variation       312
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1205214068"
     variation       314
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485238691"
     variation       316
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430871834"
     variation       328
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1258602161"
     variation       329
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888611590"
     variation       331
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947141922"
     variation       334
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175331401"
     variation       335
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354849851"
     variation       340
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779177650"
     variation       341
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381241144"
     variation       348
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463359192"
     variation       351
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571671709"
     variation       358
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1003470314"
     variation       364
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903334995"
     variation       375
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1368962100"
     variation       381
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035001659"
     variation       382
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409506020"
     variation       387
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283996220"
     variation       392
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1369871717"
     variation       393
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934840465"
     variation       400
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287156851"
     variation       404
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426863781"
     variation       405
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1217958314"
     variation       411
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366409747"
     variation       422
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184166997"
     variation       432
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:896072975"
     variation       433
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442473462"
     variation       440
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959387758"
     variation       444
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370934630"
     variation       447
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1013624114"
     variation       449
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968542600"
     exon            458..537
                     /gene="LINC01500"
                     /inference="alignment:Splign:2.1.0"
     variation       458
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326700718"
     variation       460
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1317243907"
     variation       461
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383274323"
     variation       463
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536250521"
     variation       464
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426001352"
     variation       468
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1385142952"
     variation       479
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1181877171"
     variation       481
                     /gene="LINC01500"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1451373155"
     variation       482
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242733333"
     variation       484
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142588285"
     variation       485
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:921338362"
     variation       489
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936756841"
     variation       490
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:576145339"
     variation       491
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002427471"
     variation       496
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546708020"
     variation       498
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543481314"
     variation       500
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150272888"
     variation       503
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989592546"
     variation       505
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1339512929"
     variation       510
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138683738"
     variation       516..518
                     /gene="LINC01500"
                     /replace="agg"
                     /replace="aggagg"
                     /db_xref="dbSNP:1332454829"
     variation       519
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286092216"
     variation       520
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1448918875"
     variation       530
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:987557170"
     variation       533
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1191335154"
     variation       537
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911890591"
     exon            538..566
                     /gene="LINC01500"
                     /inference="alignment:Splign:2.1.0"
     variation       538
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335401693"
     variation       545
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749960820"
     variation       546
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556390849"
     variation       555
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962884623"
     variation       558
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1433926641"
     variation       565
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186729133"
     exon            567..686
                     /gene="LINC01500"
                     /inference="alignment:Splign:2.1.0"
     variation       568
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1019389033"
     variation       569
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482790156"
     variation       570
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272514602"
     variation       574
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1020258882"
     variation       575
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971424609"
     variation       576
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981498342"
     variation       581
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034776795"
     variation       586
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959274431"
     variation       588
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991137028"
     variation       590
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920551631"
     variation       593
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930287030"
     variation       595
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570626342"
     variation       596
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952405061"
     variation       606
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907554741"
     variation       609
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566596395"
     variation       617..627
                     /gene="LINC01500"
                     /replace="caa"
                     /replace="caatcacacaa"
                     /db_xref="dbSNP:1368415607"
     variation       619
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:944406185"
     variation       622
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295599372"
     variation       626
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148946889"
     variation       637
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040151389"
     variation       639
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479685318"
     variation       643
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531072509"
     variation       644
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755648722"
     variation       648
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055096823"
     variation       657
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468732066"
     variation       658
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938056500"
     variation       664
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277886154"
     variation       679
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215396386"
     variation       680
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1055209808"
     exon            687..752
                     /gene="LINC01500"
                     /inference="alignment:Splign:2.1.0"
     variation       692
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947080832"
     variation       695
                     /gene="LINC01500"
                     /replace="g"
                     /replace="gaactg"
                     /db_xref="dbSNP:1343516550"
     variation       695
                     /gene="LINC01500"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566206386"
     variation       696
                     /gene="LINC01500"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:969660833"
     variation       700
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1043126068"
     variation       701
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924360244"
     variation       713
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194556726"
     variation       716
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165847744"
     variation       719
                     /gene="LINC01500"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191232297"
     variation       726
                     /gene="LINC01500"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057265377"
     variation       727..733
                     /gene="LINC01500"
                     /replace="a"
                     /replace="acaataa"
                     /db_xref="dbSNP:1174718470"
     variation       730
                     /gene="LINC01500"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896019444"
     variation       736
                     /gene="LINC01500"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369724905"
     variation       744
                     /gene="LINC01500"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1480408559"
ORIGIN      
aaggctgcaaacgaagccagaaagatggtggccagcacacctatggcaactatcaccacggtctccatgcttccggggagctcctgactcagtcccgttcacatcgtcctcatgggctaaggctgctggaagtggcaaactgggggaagaggatggcaggagctaggttcctccacgacacctccagagacctgagggcctcaagctgcagctccggggcacatcccgctgcgctcccacgacggccccgcggatggcaaagtcagcggcatcgcctatgcaggcaatcaaaggatgttgatggataagtgtttcaggcagaataatggccctcaaagatgttgacaccagaatcttcagaacctttgcatatgttacctaacatgacaaaagggactttgctgatgtgattaaggttaagaactttgagaagggaagattatcctggattatacaggtcgacgtttatttctttctgaactttcctggaggatcatcggccatactccagcagaagggtggatttgaaaaaataacgtttccacggcaacagtggcagcaattcaaaggaagacgttggagaattcacatgctattttagctggctctgtgattgcaatcacacaaatcattacattccagcgagatcccatcaacagaaggtttttccatttcagtctgtcaagtttttcaggcatgaatactgtaagcaagaagagaaaagttacaataaattgacatttatagttgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]