2024-05-18 12:56:58, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_106402 112 bp RNA linear PRI 02-MAY-2023 DEFINITION Gorilla gorilla gorilla microRNA mir-375 (MIR375), microRNA. ACCESSION NR_106402 VERSION NR_106402.1 KEYWORDS RefSeq. SOURCE Gorilla gorilla gorilla (western lowland gorilla) ORGANISM Gorilla gorilla gorilla Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Gorilla. REFERENCE 1 (bases 1 to 112) AUTHORS Dannemann M, Nickel B, Lizano E, Burbano HA and Kelso J. TITLE Annotation of primate miRNAs by high throughput sequencing of small RNA libraries JOURNAL BMC Genomics 13, 116 (2012) PUBMED 22453055 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 112) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JARGGP010000003.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-112 JARGGP010000003.1 110173976-110174087 c FEATURES Location/Qualifiers source 1..112 /organism="Gorilla gorilla gorilla" /mol_type="transcribed RNA" /sub_species="gorilla" /db_xref="taxon:9595" /chromosome="2B" /map="2B" gene 1..112 /gene="MIR375" /gene_synonym="ggo-mir-375" /note="microRNA mir-375" /db_xref="GeneID:102465037" /db_xref="miRBase:MI0020736" precursor_RNA 1..112 /gene="MIR375" /gene_synonym="ggo-mir-375" /product="microRNA mir-375" /db_xref="GeneID:102465037" /db_xref="miRBase:MI0020736" exon 1..112 /gene="MIR375" /gene_synonym="ggo-mir-375" /inference="alignment:Splign:2.1.0" ncRNA 71..92 /ncRNA_class="miRNA" /gene="MIR375" /gene_synonym="ggo-mir-375" /product="ggo-miR-375" /db_xref="miRBase:MIMAT0024189" /db_xref="GeneID:102465037" /db_xref="miRBase:MI0020736" ORIGIN
cgaccgccaggccccgggccctccgctcccgccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggcaggggcggcctctcagc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]