GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 12:56:58, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NR_106402                112 bp    RNA     linear   PRI 02-MAY-2023
DEFINITION  Gorilla gorilla gorilla microRNA mir-375 (MIR375), microRNA.
ACCESSION   NR_106402
VERSION     NR_106402.1
KEYWORDS    RefSeq.
SOURCE      Gorilla gorilla gorilla (western lowland gorilla)
  ORGANISM  Gorilla gorilla gorilla
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Gorilla.
REFERENCE   1  (bases 1 to 112)
  AUTHORS   Dannemann M, Nickel B, Lizano E, Burbano HA and Kelso J.
  TITLE     Annotation of primate miRNAs by high throughput sequencing of small
            RNA libraries
  JOURNAL   BMC Genomics 13, 116 (2012)
   PUBMED   22453055
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 112)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JARGGP010000003.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-112               JARGGP010000003.1  110173976-110174087 c
FEATURES             Location/Qualifiers
     source          1..112
                     /organism="Gorilla gorilla gorilla"
                     /mol_type="transcribed RNA"
                     /sub_species="gorilla"
                     /db_xref="taxon:9595"
                     /chromosome="2B"
                     /map="2B"
     gene            1..112
                     /gene="MIR375"
                     /gene_synonym="ggo-mir-375"
                     /note="microRNA mir-375"
                     /db_xref="GeneID:102465037"
                     /db_xref="miRBase:MI0020736"
     precursor_RNA   1..112
                     /gene="MIR375"
                     /gene_synonym="ggo-mir-375"
                     /product="microRNA mir-375"
                     /db_xref="GeneID:102465037"
                     /db_xref="miRBase:MI0020736"
     exon            1..112
                     /gene="MIR375"
                     /gene_synonym="ggo-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           71..92
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="ggo-mir-375"
                     /product="ggo-miR-375"
                     /db_xref="miRBase:MIMAT0024189"
                     /db_xref="GeneID:102465037"
                     /db_xref="miRBase:MI0020736"
ORIGIN      
cgaccgccaggccccgggccctccgctcccgccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggcaggggcggcctctcagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]