GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 03:23:39, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_103755               1584 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 491
            (LINC00491), transcript variant 3, long non-coding RNA.
ACCESSION   NR_103755
VERSION     NR_103755.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1584)
  AUTHORS   Li J, Liu D, Hua R, Zhang J, Liu W, Huo Y, Cheng Y, Hong J and Sun
            Y.
  TITLE     Long non-coding RNAs expressed in pancreatic ductal adenocarcinoma
            and lncRNA BC008363 an independent prognostic factor in PDAC
  JOURNAL   Pancreatology 14 (5), 385-390 (2014)
   PUBMED   25200694
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DA458823.1 and AC099487.2.
            
            Transcript Variant: This variant (3) lacks an internal exon and
            contains an alternate internal exon, resulting in a shorter
            transcript, compared to variant 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMEA2142853,
                              SAMEA2149398 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-519               DA458823.1         1-519
            520-1584            AC099487.2         57724-58788         c
FEATURES             Location/Qualifiers
     source          1..1584
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q21.1"
     gene            1..1584
                     /gene="LINC00491"
                     /note="long intergenic non-protein coding RNA 491"
                     /db_xref="GeneID:285708"
                     /db_xref="HGNC:HGNC:43428"
     ncRNA           1..1584
                     /ncRNA_class="lncRNA"
                     /gene="LINC00491"
                     /product="long intergenic non-protein coding RNA 491,
                     transcript variant 3"
                     /db_xref="GeneID:285708"
                     /db_xref="HGNC:HGNC:43428"
     exon            1..238
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182627692"
     variation       5
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:951211421"
     variation       6
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034873694"
     variation       7
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456999565"
     variation       12
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243974676"
     variation       13
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054038517"
     variation       14..16
                     /gene="LINC00491"
                     /replace="aac"
                     /replace="aacaac"
                     /db_xref="dbSNP:1392497570"
     variation       15
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971597132"
     variation       16
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003448079"
     variation       18
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1378808438"
     variation       19
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905149644"
     variation       20
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377370362"
     variation       30
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242158267"
     variation       31
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044697734"
     variation       32
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570082604"
     variation       36..38
                     /gene="LINC00491"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1459390768"
     variation       36
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551539768"
     variation       37
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:533476772"
     variation       38
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052157304"
     variation       39
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559954542"
     variation       40
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422708992"
     variation       44
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170256731"
     variation       45
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572045419"
     variation       47
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412691634"
     variation       51
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1051737267"
     variation       53
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933765270"
     variation       55
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560033813"
     variation       56
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:529539760"
     variation       57
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1483673449"
     variation       58
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1040544005"
     variation       62
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277211162"
     variation       63
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218194390"
     variation       64
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372919434"
     variation       65
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910790480"
     variation       66
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562228935"
     variation       67
                     /gene="LINC00491"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1258935094"
     variation       67
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6885654"
     variation       68
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919260566"
     variation       70..86
                     /gene="LINC00491"
                     /replace="cgcgca"
                     /replace="cgcgcatggtgcgcgca"
                     /db_xref="dbSNP:1424141767"
     variation       70
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972106456"
     variation       71
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:971495394"
     variation       72
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917347423"
     variation       73
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338475580"
     variation       75
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1399523214"
     variation       76
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577572299"
     variation       77
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556085244"
     variation       78
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278279243"
     variation       80..85
                     /gene="LINC00491"
                     /replace="gcgc"
                     /replace="gcgcgc"
                     /db_xref="dbSNP:1476150517"
     variation       80
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313166415"
     variation       81
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309607623"
     variation       82
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434090075"
     variation       83
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563304229"
     variation       84
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958801271"
     variation       86
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745509092"
     variation       87
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409050547"
     variation       88
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:982846183"
     variation       89
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951470356"
     variation       91
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034842399"
     variation       93
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298954485"
     variation       94
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003790480"
     variation       96
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189814426"
     variation       98
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019900406"
     variation       99
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998299772"
     variation       100
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544741974"
     variation       103
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969299395"
     variation       104
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900902174"
     variation       106
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223979886"
     variation       107
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217994738"
     variation       113
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023987897"
     variation       115
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577338489"
     variation       116
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245806927"
     variation       117
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267578510"
     variation       119
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:893457255"
     variation       122..123
                     /gene="LINC00491"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1329750932"
     variation       123
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438937872"
     variation       125
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370198621"
     variation       127
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919540468"
     variation       129
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1036348327"
     variation       133
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217432988"
     variation       134
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780865696"
     variation       135
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1366578973"
     variation       136
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756763528"
     variation       140
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890241550"
     variation       142
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281808992"
     variation       147
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051231903"
     variation       148
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934158930"
     variation       152
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288690469"
     variation       155
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451894097"
     variation       157
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958526866"
     variation       162
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552675720"
     variation       163
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376273848"
     variation       165
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534492051"
     variation       168
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941616937"
     variation       171
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751582047"
     variation       172
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909870456"
     variation       173
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457352024"
     variation       174
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3114587"
     variation       175
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997849044"
     variation       177
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965429469"
     variation       178
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930006460"
     variation       182
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928047277"
     variation       185
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331430568"
     variation       187
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339289379"
     variation       188
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445172644"
     variation       189
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426235298"
     variation       194
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017999722"
     variation       197
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255794557"
     variation       198
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981939377"
     variation       199
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199099270"
     variation       200..202
                     /gene="LINC00491"
                     /replace="cgg"
                     /replace="gga"
                     /db_xref="dbSNP:796805507"
     variation       200
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969645827"
     variation       201
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3105473"
     variation       202
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898069452"
     variation       205
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423239283"
     variation       210
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254354264"
     variation       214..215
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1170077959"
     variation       215
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466460730"
     variation       216
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400525903"
     variation       217
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:989792798"
     variation       219
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311535803"
     variation       221..225
                     /gene="LINC00491"
                     /replace=""
                     /replace="atctt"
                     /db_xref="dbSNP:1275889685"
     variation       224
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301712271"
     variation       226
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957983706"
     variation       227
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191360414"
     variation       230
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1362545600"
     variation       231
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569912623"
     variation       234
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172310843"
     variation       235
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950059414"
     variation       236
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890168078"
     exon            239..309
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       240
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280126590"
     variation       244
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418649987"
     variation       247
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975331829"
     variation       248
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240913584"
     variation       252
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434283874"
     variation       256
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329072172"
     variation       269..274
                     /gene="LINC00491"
                     /replace=""
                     /replace="aacatc"
                     /db_xref="dbSNP:762353394"
     variation       276
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962335435"
     variation       277
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1388581027"
     variation       283
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304892428"
     variation       297..298
                     /gene="LINC00491"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1241097110"
     variation       298
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386942832"
     variation       300
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:986107096"
     variation       301..302
                     /gene="LINC00491"
                     /replace=""
                     /replace="taa"
                     /db_xref="dbSNP:1357713474"
     variation       308
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396263515"
     exon            310..1584
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       314
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938821816"
     variation       317
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310791920"
     variation       321
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029714140"
     variation       330
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561532874"
     variation       332
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977277774"
     variation       344
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290091051"
     variation       347
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963911643"
     variation       350
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323319499"
     variation       357
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196497055"
     variation       358
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445931186"
     variation       371
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237547879"
     variation       380
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458149512"
     variation       381
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1018087745"
     variation       388
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180662545"
     variation       399
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401010161"
     variation       402
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235811498"
     variation       414
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044260691"
     variation       420
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947258897"
     variation       421
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416176826"
     variation       422
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005412501"
     variation       424
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1408611532"
     variation       427..428
                     /gene="LINC00491"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1170379936"
     variation       442
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401731886"
     variation       445
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561063618"
     variation       448
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449641847"
     variation       453
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888335554"
     variation       468..469
                     /gene="LINC00491"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1338219392"
     variation       469
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025536341"
     variation       471
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182534989"
     variation       472
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988769251"
     variation       486
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380862281"
     variation       498
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:906224959"
     variation       499
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216635662"
     variation       508
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046144547"
     variation       513..515
                     /gene="LINC00491"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1318251356"
     variation       523
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771704250"
     variation       525
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:986916438"
     variation       530
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947819220"
     variation       534
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953803955"
     variation       538
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163426909"
     variation       540
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1476955246"
     variation       546
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193475425"
     variation       552
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473591708"
     variation       555
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894628195"
     variation       559
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029087457"
     variation       562
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467469853"
     variation       569
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747637941"
     variation       577
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370906737"
     variation       578
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402084143"
     variation       579
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974899253"
     variation       581
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778973212"
     variation       583
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192742199"
     variation       585..587
                     /gene="LINC00491"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1360608293"
     variation       588
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926156268"
     variation       590
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458603870"
     variation       591
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240499523"
     variation       594
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977679127"
     variation       607
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016913818"
     variation       608
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277116142"
     variation       617
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946063512"
     variation       618
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005165853"
     variation       631..632
                     /gene="LINC00491"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1220195521"
     variation       635
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273045919"
     variation       636
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1344186995"
     variation       643
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1201162416"
     variation       646
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922636006"
     variation       649
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280819055"
     variation       651
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487308661"
     variation       655
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216175546"
     variation       656
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264126509"
     variation       666
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545278073"
     variation       671
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561532764"
     variation       675
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451347826"
     variation       683
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377616847"
     variation       685
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574366566"
     variation       689
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:552912109"
     variation       692
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230213057"
     variation       695
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035699599"
     variation       698
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297233703"
     variation       706
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72781850"
     variation       716
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911321038"
     variation       718
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905961410"
     variation       725
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321320592"
     variation       735
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983897286"
     variation       736
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753740225"
     variation       760
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241041758"
     variation       761
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233880946"
     variation       768
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276480217"
     variation       770
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351644624"
     variation       773
                     /gene="LINC00491"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1287073494"
     variation       773
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114522914"
     variation       777
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535054006"
     variation       778
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281152176"
     variation       779
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370692425"
     variation       783
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994530856"
     variation       784
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567632258"
     variation       787
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053437642"
     variation       796
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934598149"
     variation       797
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1378962261"
     variation       802
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025088456"
     variation       803..822
                     /gene="LINC00491"
                     /replace=""
                     /replace="tgagttcattagtcagaaaa"
                     /db_xref="dbSNP:1358307067"
     variation       803
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555804389"
     variation       805..840
                     /gene="LINC00491"
                     /replace=""
                     /replace="agttcattagtcagaaaaagggaaaataccaccacc"
                     /db_xref="dbSNP:1026486700"
     variation       817
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1161026103"
     variation       819
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1011925803"
     variation       825..840
                     /gene="LINC00491"
                     /replace=""
                     /replace="ggaaaataccaccacc"
                     /db_xref="dbSNP:1439714456"
     variation       827..830
                     /gene="LINC00491"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1157681358"
     variation       833
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537165543"
     variation       854
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920993507"
     variation       860
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973820772"
     variation       863
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446212721"
     variation       864
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310074927"
     variation       867
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:963504148"
     variation       875
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79439168"
     variation       884
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189945856"
     variation       899
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984072856"
     variation       901
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757429098"
     variation       904
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457700051"
     variation       905
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478012575"
     variation       916
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177536371"
     variation       920
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1247637257"
     variation       921
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951007140"
     variation       930
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420289212"
     variation       943
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1162281237"
     variation       949
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141837376"
     variation       969
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458268051"
     variation       979..983
                     /gene="LINC00491"
                     /replace=""
                     /replace="acata"
                     /db_xref="dbSNP:1398112179"
     variation       983
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533436827"
     variation       984
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465044683"
     variation       987
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7723461"
     variation       989
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904727875"
     variation       991
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041991126"
     variation       995
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312326878"
     variation       996
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188560442"
     variation       999
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256553749"
     variation       1007
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317602683"
     variation       1010..1011
                     /gene="LINC00491"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1276625480"
     variation       1015
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199833757"
     variation       1026
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260492509"
     variation       1027
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7723320"
     variation       1032
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179589806"
     variation       1033
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041415255"
     variation       1034
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868573996"
     variation       1036
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255117963"
     variation       1037
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424028749"
     variation       1044
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1189540974"
     variation       1048
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942736718"
     variation       1050
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421227529"
     variation       1051
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:911268399"
     variation       1064
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370267671"
     variation       1065
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139987955"
     variation       1070
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356173407"
     variation       1075
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338164463"
     variation       1077
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302321051"
     variation       1081
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3105485"
     variation       1083
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416857237"
     variation       1084
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892920752"
     variation       1087
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276470908"
     variation       1088
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340317454"
     variation       1092
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952544002"
     variation       1096
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219585904"
     variation       1100
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487063798"
     variation       1107
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918443329"
     variation       1112
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052965513"
     variation       1115
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569394714"
     variation       1118
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1173407550"
     variation       1120
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414392176"
     variation       1124
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426562316"
     variation       1126..1132
                     /gene="LINC00491"
                     /replace="aaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:891061516"
     variation       1126
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183558415"
     variation       1128
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1477010925"
     variation       1141
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487863559"
     variation       1142
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194086754"
     variation       1143
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:971020335"
     variation       1152
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765800602"
     variation       1159
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537936462"
     variation       1176
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563472919"
     variation       1180
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012284962"
     variation       1181
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545267367"
     variation       1182
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194605319"
     variation       1188
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1486994166"
     variation       1192
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175190424"
     variation       1197
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254308230"
     variation       1198
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762987732"
     variation       1199
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296612883"
     variation       1205
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1032087113"
     variation       1212
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000658022"
     variation       1219
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373533926"
     variation       1223
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551032940"
     variation       1224
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225298678"
     variation       1234
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315792725"
     variation       1236
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277375761"
     variation       1245
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400207049"
     variation       1249
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363714043"
     variation       1253
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920961053"
     variation       1254
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302526228"
     variation       1259
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348016856"
     variation       1261..1264
                     /gene="LINC00491"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1283497928"
     variation       1262
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235813039"
     variation       1268
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038080705"
     variation       1270
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042309976"
     variation       1273
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010419736"
     variation       1274
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243637891"
     variation       1277
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487348112"
     variation       1278
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192225692"
     variation       1280
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983652873"
     variation       1283
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765683622"
     variation       1284
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112722049"
     variation       1291
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911260158"
     variation       1293
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420547324"
     variation       1294
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048443365"
     variation       1295
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529590716"
     variation       1296
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348525268"
     variation       1300
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1436159119"
     variation       1311..1316
                     /gene="LINC00491"
                     /replace="tt"
                     /replace="tttctt"
                     /db_xref="dbSNP:756980392"
     variation       1314
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294674171"
     variation       1316
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573945787"
     variation       1320
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760047014"
     variation       1322
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352250954"
     variation       1326
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224005909"
     variation       1327
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972954818"
     variation       1329
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285853194"
     variation       1337
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319732757"
     variation       1341
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555343945"
     variation       1344
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220513760"
     variation       1358
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1430508085"
     variation       1366
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56170429"
     variation       1368
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187388775"
     variation       1372
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237663539"
     variation       1377
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116239642"
     variation       1378
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959025549"
     variation       1386
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411860473"
     variation       1388
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760472655"
     variation       1405
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050960697"
     variation       1407
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77026938"
     variation       1424
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205451867"
     variation       1425
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331194350"
     variation       1435
                     /gene="LINC00491"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1561532489"
     variation       1435
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375542608"
     variation       1438
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442243976"
     variation       1447
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566161685"
     variation       1448
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:60284576"
     variation       1449
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747684484"
     variation       1451
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010782778"
     variation       1456
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372808956"
     variation       1458
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182199550"
     variation       1462
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020282343"
     variation       1465
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196701183"
     variation       1469
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038010507"
     variation       1475
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567208956"
     variation       1479
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047277231"
     variation       1484..1488
                     /gene="LINC00491"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1310060746"
     variation       1485..1492
                     /gene="LINC00491"
                     /replace="aga"
                     /replace="agaacaga"
                     /db_xref="dbSNP:1220701531"
     variation       1486
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472588800"
     variation       1490
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188839246"
     variation       1496
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420489315"
     variation       1501
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929478809"
     variation       1508
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928830831"
     variation       1510
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889769244"
     variation       1511
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048350557"
     variation       1513
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931331266"
     variation       1519
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330292135"
     variation       1520..1526
                     /gene="LINC00491"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1356870487"
     variation       1528
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897191537"
     variation       1529
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149498756"
     variation       1536
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990166576"
     variation       1550
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216535965"
     variation       1554
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957624056"
     variation       1557
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530616133"
     variation       1558..1560
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1339980026"
     variation       1570
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332454253"
     variation       1574
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031741670"
     variation       1576..1577
                     /gene="LINC00491"
                     /replace=""
                     /replace="atgcaaaaagtgc"
                     /db_xref="dbSNP:1197783780"
     variation       1577
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202060431"
     variation       1578..1579
                     /gene="LINC00491"
                     /replace=""
                     /replace="ctttttgcatcaa"
                     /db_xref="dbSNP:1554082265"
     variation       1578..1579
                     /gene="LINC00491"
                     /replace="ca"
                     /replace="cactttttgcatca"
                     /replace="cactttttgcgtca"
                     /db_xref="dbSNP:59087646"
     variation       1578
                     /gene="LINC00491"
                     /replace="c"
                     /replace="ctctttttgcatc"
                     /db_xref="dbSNP:1463799317"
     variation       1580
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201159036"
     variation       1581
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200023150"
ORIGIN      
gactcggaaagggaactccctgaccccttgcgcttcccgagtgaggcaatgcctcgccctgcttcgactcgcgcatggtgcgcgcacgcactgacctgcgcccactgtctggcactccctagtgagatgaacccggtacctcagatggaaatgcagaaatcaccagtcttctgcgtcgctcacgctgggagctgtagaccggagctgttcctattcggccatcttgtctcctcccgtgggcttttggctcaattctgaataaacagtgaacatccatgtgggagcaatgaggaggaactgtagcatctgaactggaaattccctgtctccccttaaccagcactggaagcagatgggaagagaatagctgtgactgactcacactctaacccagcaaccctcagcatacaagtgggagaccataaagtttttcaagaccccaaaagaggccaaaggtctgataattgctgggagaaggtccactatccaagaagagaagaggaaaaggaattaaagtctccaagcactggggatgcaagaagagagttgcacaggagagaaagaagaagttgtccacggggtgaccctgcaattggagggaaatgcatgtggatatgtgcagggagtctaggaagtgaagccttagtgatcatttacaagaatgagggttaggtaaaataagggatgcaaagccacctgtagtctattctaacctcactccatcactctatacaatctgtgttttatcatctgaaatgttaagtaaagacctgtttgggtcttcttcagaatcccatacatttgagttcattagtcagaaaaagggaaaataccaccaccccatcctggaatggcagtcatgtacacttttataatgagagattgggcagcaaagggggccccttgtggacctcacccagccagagaaggaggcagaatgtttcctttactatcttttcctctccccagaggaacactacatattgttccctccatgggcttaagagaaggtgccagggttacagatagatatatcgctagctgtagagcacagggtgaattgggatgtccatgtacaaagctagggacaggagaatcagtttaaagactttaaaaataattaggaaaaaaaggaaggcctgacccaaagcttaggagtgcaggtagagaagagatggtgccatgatataccatgtctctgggacttttctgtattcctcttcctctgtatactgtattgccctcattccctatttattcaaaatctgtgctacctccactgcgaagacttccacgagaaaattcagatatttcttcttttgtggacactttctaccttacaaataagttaattttaattcaaggaagagtttttccggaaccctgttggcctgctcacaggaatgtaagttccttaaatctagggcacagtgtctttgagaactgcaatcacctacatcaacatgacatagctattaggactaagaacagagaccacctgtgtcaacatgagttactatttttttccgtgaaacatttgtccaagaaagataagactgtaaccaataaatagtttgcaagtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]