GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:18:47, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_103754               1647 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 491
            (LINC00491), transcript variant 2, long non-coding RNA.
ACCESSION   NR_103754
VERSION     NR_103754.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1647)
  AUTHORS   Li J, Liu D, Hua R, Zhang J, Liu W, Huo Y, Cheng Y, Hong J and Sun
            Y.
  TITLE     Long non-coding RNAs expressed in pancreatic ductal adenocarcinoma
            and lncRNA BC008363 an independent prognostic factor in PDAC
  JOURNAL   Pancreatology 14 (5), 385-390 (2014)
   PUBMED   25200694
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DA458823.1, CN270888.1 and AC099487.2.
            
            Transcript Variant: This variant (2) lacks an internal exon and
            contains two alternate internal exons, resulting in a shorter
            transcript, compared to variant 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMEA2148874,
                              SAMEA2149398 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-201               DA458823.1         1-201
            202-819             CN270888.1         45-662
            820-1647            AC099487.2         57724-58551         c
FEATURES             Location/Qualifiers
     source          1..1647
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q21.1"
     gene            1..1647
                     /gene="LINC00491"
                     /note="long intergenic non-protein coding RNA 491"
                     /db_xref="GeneID:285708"
                     /db_xref="HGNC:HGNC:43428"
     ncRNA           1..1647
                     /ncRNA_class="lncRNA"
                     /gene="LINC00491"
                     /product="long intergenic non-protein coding RNA 491,
                     transcript variant 2"
                     /db_xref="GeneID:285708"
                     /db_xref="HGNC:HGNC:43428"
     exon            1..238
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182627692"
     variation       5
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:951211421"
     variation       6
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034873694"
     variation       7
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456999565"
     variation       12
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243974676"
     variation       13
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054038517"
     variation       14..16
                     /gene="LINC00491"
                     /replace="aac"
                     /replace="aacaac"
                     /db_xref="dbSNP:1392497570"
     variation       15
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971597132"
     variation       16
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003448079"
     variation       18
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1378808438"
     variation       19
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905149644"
     variation       20
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377370362"
     variation       30
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242158267"
     variation       31
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044697734"
     variation       32
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570082604"
     variation       36..38
                     /gene="LINC00491"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1459390768"
     variation       36
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551539768"
     variation       37
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:533476772"
     variation       38
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052157304"
     variation       39
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559954542"
     variation       40
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422708992"
     variation       44
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170256731"
     variation       45
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572045419"
     variation       47
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412691634"
     variation       51
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1051737267"
     variation       53
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933765270"
     variation       55
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560033813"
     variation       56
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:529539760"
     variation       57
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1483673449"
     variation       58
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1040544005"
     variation       62
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277211162"
     variation       63
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218194390"
     variation       64
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372919434"
     variation       65
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910790480"
     variation       66
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562228935"
     variation       67
                     /gene="LINC00491"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1258935094"
     variation       67
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6885654"
     variation       68
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919260566"
     variation       70..86
                     /gene="LINC00491"
                     /replace="cgcgca"
                     /replace="cgcgcatggtgcgcgca"
                     /db_xref="dbSNP:1424141767"
     variation       70
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972106456"
     variation       71
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:971495394"
     variation       72
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917347423"
     variation       73
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338475580"
     variation       75
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1399523214"
     variation       76
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577572299"
     variation       77
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556085244"
     variation       78
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278279243"
     variation       80..85
                     /gene="LINC00491"
                     /replace="gcgc"
                     /replace="gcgcgc"
                     /db_xref="dbSNP:1476150517"
     variation       80
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313166415"
     variation       81
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309607623"
     variation       82
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434090075"
     variation       83
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563304229"
     variation       84
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958801271"
     variation       86
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745509092"
     variation       87
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409050547"
     variation       88
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:982846183"
     variation       89
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951470356"
     variation       91
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034842399"
     variation       93
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298954485"
     variation       94
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003790480"
     variation       96
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189814426"
     variation       98
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019900406"
     variation       99
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998299772"
     variation       100
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544741974"
     variation       103
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969299395"
     variation       104
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900902174"
     variation       106
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223979886"
     variation       107
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217994738"
     variation       113
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023987897"
     variation       115
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577338489"
     variation       116
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245806927"
     variation       117
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267578510"
     variation       119
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:893457255"
     variation       122..123
                     /gene="LINC00491"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1329750932"
     variation       123
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438937872"
     variation       125
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370198621"
     variation       127
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919540468"
     variation       129
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1036348327"
     variation       133
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217432988"
     variation       134
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780865696"
     variation       135
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1366578973"
     variation       136
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756763528"
     variation       140
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890241550"
     variation       142
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281808992"
     variation       147
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051231903"
     variation       148
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934158930"
     variation       152
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288690469"
     variation       155
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451894097"
     variation       157
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958526866"
     variation       162
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552675720"
     variation       163
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376273848"
     variation       165
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534492051"
     variation       168
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941616937"
     variation       171
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751582047"
     variation       172
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909870456"
     variation       173
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457352024"
     variation       174
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3114587"
     variation       175
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997849044"
     variation       177
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965429469"
     variation       178
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930006460"
     variation       182
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928047277"
     variation       185
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331430568"
     variation       187
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339289379"
     variation       188
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445172644"
     variation       189
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426235298"
     variation       194
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017999722"
     variation       197
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255794557"
     variation       198
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981939377"
     variation       199
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199099270"
     variation       200..202
                     /gene="LINC00491"
                     /replace="cgg"
                     /replace="gga"
                     /db_xref="dbSNP:796805507"
     variation       200
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969645827"
     variation       201
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3105473"
     variation       202
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898069452"
     variation       205
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423239283"
     variation       210
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254354264"
     variation       214..215
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1170077959"
     variation       215
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466460730"
     variation       216
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400525903"
     variation       217
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:989792798"
     variation       219
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311535803"
     variation       221..225
                     /gene="LINC00491"
                     /replace=""
                     /replace="atctt"
                     /db_xref="dbSNP:1275889685"
     variation       224
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301712271"
     variation       226
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957983706"
     variation       227
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191360414"
     variation       230
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1362545600"
     variation       231
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569912623"
     variation       234
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172310843"
     variation       235
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950059414"
     variation       236
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890168078"
     exon            239..309
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       240
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280126590"
     variation       244
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418649987"
     variation       247
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975331829"
     variation       248
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240913584"
     variation       252
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434283874"
     variation       256
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329072172"
     variation       269..274
                     /gene="LINC00491"
                     /replace=""
                     /replace="aacatc"
                     /db_xref="dbSNP:762353394"
     variation       276
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962335435"
     variation       277
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1388581027"
     variation       283
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304892428"
     variation       297..298
                     /gene="LINC00491"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1241097110"
     variation       298
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386942832"
     variation       300
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:986107096"
     variation       301..302
                     /gene="LINC00491"
                     /replace=""
                     /replace="taa"
                     /db_xref="dbSNP:1357713474"
     variation       308
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396263515"
     exon            310..372
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       311
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918038721"
     variation       315
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537503006"
     variation       328
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1226997775"
     variation       331..333
                     /gene="LINC00491"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:35344064"
     variation       332
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283968990"
     variation       335
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448144626"
     variation       347
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535125810"
     variation       348
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914434972"
     variation       350
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269211443"
     variation       351
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349276388"
     variation       354
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1165198042"
     variation       356..357
                     /gene="LINC00491"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1406941555"
     variation       359
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753652295"
     variation       363
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405539304"
     variation       368
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:955685282"
     variation       371
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568001405"
     exon            373..1647
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       377
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938821816"
     variation       380
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310791920"
     variation       384
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029714140"
     variation       393
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561532874"
     variation       395
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977277774"
     variation       407
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290091051"
     variation       410
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963911643"
     variation       413
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323319499"
     variation       420
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196497055"
     variation       421
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445931186"
     variation       434
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237547879"
     variation       443
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458149512"
     variation       444
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1018087745"
     variation       451
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180662545"
     variation       462
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401010161"
     variation       465
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235811498"
     variation       477
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044260691"
     variation       483
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947258897"
     variation       484
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416176826"
     variation       485
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005412501"
     variation       487
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1408611532"
     variation       490..491
                     /gene="LINC00491"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1170379936"
     variation       505
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401731886"
     variation       508
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561063618"
     variation       511
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449641847"
     variation       516
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888335554"
     variation       531..532
                     /gene="LINC00491"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1338219392"
     variation       532
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025536341"
     variation       534
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182534989"
     variation       535
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988769251"
     variation       549
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380862281"
     variation       561
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:906224959"
     variation       562
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216635662"
     variation       571
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046144547"
     variation       576..578
                     /gene="LINC00491"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1318251356"
     variation       586
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771704250"
     variation       588
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:986916438"
     variation       593
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947819220"
     variation       597
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953803955"
     variation       601
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163426909"
     variation       603
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1476955246"
     variation       609
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193475425"
     variation       615
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473591708"
     variation       618
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894628195"
     variation       622
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029087457"
     variation       625
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467469853"
     variation       632
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747637941"
     variation       640
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370906737"
     variation       641
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402084143"
     variation       642
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974899253"
     variation       644
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778973212"
     variation       646
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192742199"
     variation       648..650
                     /gene="LINC00491"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1360608293"
     variation       651
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926156268"
     variation       653
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458603870"
     variation       654
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240499523"
     variation       657
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977679127"
     variation       670
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016913818"
     variation       671
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277116142"
     variation       680
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946063512"
     variation       681
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005165853"
     variation       694..695
                     /gene="LINC00491"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1220195521"
     variation       698
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273045919"
     variation       699
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1344186995"
     variation       706
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1201162416"
     variation       709
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922636006"
     variation       712
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280819055"
     variation       714
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487308661"
     variation       718
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216175546"
     variation       719
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264126509"
     variation       729
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545278073"
     variation       734
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561532764"
     variation       738
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451347826"
     variation       746
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377616847"
     variation       748
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574366566"
     variation       752
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:552912109"
     variation       755
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230213057"
     variation       758
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035699599"
     variation       761
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297233703"
     variation       769
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72781850"
     variation       779
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911321038"
     variation       781
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905961410"
     variation       788
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321320592"
     variation       798
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983897286"
     variation       799
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753740225"
     variation       823
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241041758"
     variation       824
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233880946"
     variation       831
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276480217"
     variation       833
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351644624"
     variation       836
                     /gene="LINC00491"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1287073494"
     variation       836
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114522914"
     variation       840
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535054006"
     variation       841
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281152176"
     variation       842
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370692425"
     variation       846
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994530856"
     variation       847
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567632258"
     variation       850
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053437642"
     variation       859
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934598149"
     variation       860
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1378962261"
     variation       865
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025088456"
     variation       866..885
                     /gene="LINC00491"
                     /replace=""
                     /replace="tgagttcattagtcagaaaa"
                     /db_xref="dbSNP:1358307067"
     variation       866
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555804389"
     variation       868..903
                     /gene="LINC00491"
                     /replace=""
                     /replace="agttcattagtcagaaaaagggaaaataccaccacc"
                     /db_xref="dbSNP:1026486700"
     variation       880
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1161026103"
     variation       882
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1011925803"
     variation       888..903
                     /gene="LINC00491"
                     /replace=""
                     /replace="ggaaaataccaccacc"
                     /db_xref="dbSNP:1439714456"
     variation       890..893
                     /gene="LINC00491"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1157681358"
     variation       896
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537165543"
     variation       917
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920993507"
     variation       923
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973820772"
     variation       926
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446212721"
     variation       927
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310074927"
     variation       930
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:963504148"
     variation       938
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79439168"
     variation       947
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189945856"
     variation       962
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984072856"
     variation       964
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757429098"
     variation       967
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457700051"
     variation       968
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478012575"
     variation       979
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177536371"
     variation       983
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1247637257"
     variation       984
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951007140"
     variation       993
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420289212"
     variation       1006
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1162281237"
     variation       1012
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141837376"
     variation       1032
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458268051"
     variation       1042..1046
                     /gene="LINC00491"
                     /replace=""
                     /replace="acata"
                     /db_xref="dbSNP:1398112179"
     variation       1046
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533436827"
     variation       1047
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465044683"
     variation       1050
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7723461"
     variation       1052
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904727875"
     variation       1054
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041991126"
     variation       1058
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312326878"
     variation       1059
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188560442"
     variation       1062
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256553749"
     variation       1070
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317602683"
     variation       1073..1074
                     /gene="LINC00491"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1276625480"
     variation       1078
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199833757"
     variation       1089
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260492509"
     variation       1090
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7723320"
     variation       1095
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179589806"
     variation       1096
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041415255"
     variation       1097
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868573996"
     variation       1099
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255117963"
     variation       1100
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424028749"
     variation       1107
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1189540974"
     variation       1111
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942736718"
     variation       1113
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421227529"
     variation       1114
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:911268399"
     variation       1127
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370267671"
     variation       1128
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139987955"
     variation       1133
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356173407"
     variation       1138
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338164463"
     variation       1140
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302321051"
     variation       1144
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3105485"
     variation       1146
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416857237"
     variation       1147
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892920752"
     variation       1150
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276470908"
     variation       1151
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340317454"
     variation       1155
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952544002"
     variation       1159
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219585904"
     variation       1163
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487063798"
     variation       1170
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918443329"
     variation       1175
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052965513"
     variation       1178
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569394714"
     variation       1181
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1173407550"
     variation       1183
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414392176"
     variation       1187
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426562316"
     variation       1189..1195
                     /gene="LINC00491"
                     /replace="aaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:891061516"
     variation       1189
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183558415"
     variation       1191
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1477010925"
     variation       1204
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487863559"
     variation       1205
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194086754"
     variation       1206
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:971020335"
     variation       1215
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765800602"
     variation       1222
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537936462"
     variation       1239
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563472919"
     variation       1243
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012284962"
     variation       1244
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545267367"
     variation       1245
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194605319"
     variation       1251
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1486994166"
     variation       1255
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175190424"
     variation       1260
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254308230"
     variation       1261
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762987732"
     variation       1262
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296612883"
     variation       1268
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1032087113"
     variation       1275
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000658022"
     variation       1282
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373533926"
     variation       1286
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551032940"
     variation       1287
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225298678"
     variation       1297
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315792725"
     variation       1299
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277375761"
     variation       1308
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400207049"
     variation       1312
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363714043"
     variation       1316
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920961053"
     variation       1317
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302526228"
     variation       1322
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348016856"
     variation       1324..1327
                     /gene="LINC00491"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1283497928"
     variation       1325
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235813039"
     variation       1331
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038080705"
     variation       1333
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042309976"
     variation       1336
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010419736"
     variation       1337
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243637891"
     variation       1340
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487348112"
     variation       1341
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192225692"
     variation       1343
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983652873"
     variation       1346
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765683622"
     variation       1347
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112722049"
     variation       1354
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911260158"
     variation       1356
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420547324"
     variation       1357
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048443365"
     variation       1358
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529590716"
     variation       1359
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348525268"
     variation       1363
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1436159119"
     variation       1374..1379
                     /gene="LINC00491"
                     /replace="tt"
                     /replace="tttctt"
                     /db_xref="dbSNP:756980392"
     variation       1377
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294674171"
     variation       1379
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573945787"
     variation       1383
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760047014"
     variation       1385
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352250954"
     variation       1389
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224005909"
     variation       1390
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972954818"
     variation       1392
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285853194"
     variation       1400
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319732757"
     variation       1404
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555343945"
     variation       1407
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220513760"
     variation       1421
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1430508085"
     variation       1429
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56170429"
     variation       1431
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187388775"
     variation       1435
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237663539"
     variation       1440
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116239642"
     variation       1441
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959025549"
     variation       1449
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411860473"
     variation       1451
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760472655"
     variation       1468
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050960697"
     variation       1470
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77026938"
     variation       1487
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205451867"
     variation       1488
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331194350"
     variation       1498
                     /gene="LINC00491"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1561532489"
     variation       1498
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375542608"
     variation       1501
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442243976"
     variation       1510
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566161685"
     variation       1511
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:60284576"
     variation       1512
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747684484"
     variation       1514
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010782778"
     variation       1519
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372808956"
     variation       1521
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182199550"
     variation       1525
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020282343"
     variation       1528
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196701183"
     variation       1532
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038010507"
     variation       1538
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567208956"
     variation       1542
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047277231"
     variation       1547..1551
                     /gene="LINC00491"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1310060746"
     variation       1548..1555
                     /gene="LINC00491"
                     /replace="aga"
                     /replace="agaacaga"
                     /db_xref="dbSNP:1220701531"
     variation       1549
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472588800"
     variation       1553
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188839246"
     variation       1559
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420489315"
     variation       1564
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929478809"
     variation       1571
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928830831"
     variation       1573
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889769244"
     variation       1574
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048350557"
     variation       1576
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931331266"
     variation       1582
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330292135"
     variation       1583..1589
                     /gene="LINC00491"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1356870487"
     variation       1591
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897191537"
     variation       1592
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149498756"
     variation       1599
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990166576"
     variation       1613
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216535965"
     variation       1617
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957624056"
     variation       1620
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530616133"
     variation       1621..1623
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1339980026"
     variation       1633
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332454253"
     variation       1637
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031741670"
     variation       1639..1640
                     /gene="LINC00491"
                     /replace=""
                     /replace="atgcaaaaagtgc"
                     /db_xref="dbSNP:1197783780"
     variation       1640
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202060431"
     variation       1641..1642
                     /gene="LINC00491"
                     /replace=""
                     /replace="ctttttgcatcaa"
                     /db_xref="dbSNP:1554082265"
     variation       1641..1642
                     /gene="LINC00491"
                     /replace="ca"
                     /replace="cactttttgcatca"
                     /replace="cactttttgcgtca"
                     /db_xref="dbSNP:59087646"
     variation       1641
                     /gene="LINC00491"
                     /replace="c"
                     /replace="ctctttttgcatc"
                     /db_xref="dbSNP:1463799317"
     variation       1643
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201159036"
     variation       1644
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200023150"
ORIGIN      
gactcggaaagggaactccctgaccccttgcgcttcccgagtgaggcaatgcctcgccctgcttcgactcgcgcatggtgcgcgcacgcactgacctgcgcccactgtctggcactccctagtgagatgaacccggtacctcagatggaaatgcagaaatcaccagtcttctgcgtcgctcacgctgggagctgtagaccggagctgttcctattcggccatcttgtctcctcccgtgggcttttggctcaattctgaataaacagtgaacatccatgtgggagcaatgaggaggaactgtagcatctggaacagtccaaaaaggaagctgggagtcagcccatcacgaggttgcttgatcagaatcacatgaactggaaattccctgtctccccttaaccagcactggaagcagatgggaagagaatagctgtgactgactcacactctaacccagcaaccctcagcatacaagtgggagaccataaagtttttcaagaccccaaaagaggccaaaggtctgataattgctgggagaaggtccactatccaagaagagaagaggaaaaggaattaaagtctccaagcactggggatgcaagaagagagttgcacaggagagaaagaagaagttgtccacggggtgaccctgcaattggagggaaatgcatgtggatatgtgcagggagtctaggaagtgaagccttagtgatcatttacaagaatgagggttaggtaaaataagggatgcaaagccacctgtagtctattctaacctcactccatcactctatacaatctgtgttttatcatctgaaatgttaagtaaagacctgtttgggtcttcttcagaatcccatacatttgagttcattagtcagaaaaagggaaaataccaccaccccatcctggaatggcagtcatgtacacttttataatgagagattgggcagcaaagggggccccttgtggacctcacccagccagagaaggaggcagaatgtttcctttactatcttttcctctccccagaggaacactacatattgttccctccatgggcttaagagaaggtgccagggttacagatagatatatcgctagctgtagagcacagggtgaattgggatgtccatgtacaaagctagggacaggagaatcagtttaaagactttaaaaataattaggaaaaaaaggaaggcctgacccaaagcttaggagtgcaggtagagaagagatggtgccatgatataccatgtctctgggacttttctgtattcctcttcctctgtatactgtattgccctcattccctatttattcaaaatctgtgctacctccactgcgaagacttccacgagaaaattcagatatttcttcttttgtggacactttctaccttacaaataagttaattttaattcaaggaagagtttttccggaaccctgttggcctgctcacaggaatgtaagttccttaaatctagggcacagtgtctttgagaactgcaatcacctacatcaacatgacatagctattaggactaagaacagagaccacctgtgtcaacatgagttactatttttttccgtgaaacatttgtccaagaaagataagactgtaaccaataaatagtttgcaagtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]