GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:24:56, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_103753               1662 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 491
            (LINC00491), transcript variant 1, long non-coding RNA.
ACCESSION   NR_103753
VERSION     NR_103753.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1662)
  AUTHORS   Li J, Liu D, Hua R, Zhang J, Liu W, Huo Y, Cheng Y, Hong J and Sun
            Y.
  TITLE     Long non-coding RNAs expressed in pancreatic ductal adenocarcinoma
            and lncRNA BC008363 an independent prognostic factor in PDAC
  JOURNAL   Pancreatology 14 (5), 385-390 (2014)
   PUBMED   25200694
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DA458823.1, DA458115.1 and AC099487.2.
            
            Transcript Variant: This variant (1) represents the longest
            transcript.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA458115.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA2149178, SAMEA2149398
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-181               DA458823.1         1-181
            182-763             DA458115.1         1-582
            764-1662            AC099487.2         57724-58622         c
FEATURES             Location/Qualifiers
     source          1..1662
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q21.1"
     gene            1..1662
                     /gene="LINC00491"
                     /note="long intergenic non-protein coding RNA 491"
                     /db_xref="GeneID:285708"
                     /db_xref="HGNC:HGNC:43428"
     ncRNA           1..1662
                     /ncRNA_class="lncRNA"
                     /gene="LINC00491"
                     /product="long intergenic non-protein coding RNA 491,
                     transcript variant 1"
                     /db_xref="GeneID:285708"
                     /db_xref="HGNC:HGNC:43428"
     exon            1..238
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182627692"
     variation       5
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:951211421"
     variation       6
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034873694"
     variation       7
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456999565"
     variation       12
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243974676"
     variation       13
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054038517"
     variation       14..16
                     /gene="LINC00491"
                     /replace="aac"
                     /replace="aacaac"
                     /db_xref="dbSNP:1392497570"
     variation       15
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971597132"
     variation       16
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003448079"
     variation       18
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1378808438"
     variation       19
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905149644"
     variation       20
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377370362"
     variation       30
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242158267"
     variation       31
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044697734"
     variation       32
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570082604"
     variation       36..38
                     /gene="LINC00491"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1459390768"
     variation       36
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551539768"
     variation       37
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:533476772"
     variation       38
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052157304"
     variation       39
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559954542"
     variation       40
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422708992"
     variation       44
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170256731"
     variation       45
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572045419"
     variation       47
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412691634"
     variation       51
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1051737267"
     variation       53
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933765270"
     variation       55
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560033813"
     variation       56
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:529539760"
     variation       57
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1483673449"
     variation       58
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1040544005"
     variation       62
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277211162"
     variation       63
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218194390"
     variation       64
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372919434"
     variation       65
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910790480"
     variation       66
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562228935"
     variation       67
                     /gene="LINC00491"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1258935094"
     variation       67
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6885654"
     variation       68
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919260566"
     variation       70..86
                     /gene="LINC00491"
                     /replace="cgcgca"
                     /replace="cgcgcatggtgcgcgca"
                     /db_xref="dbSNP:1424141767"
     variation       70
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972106456"
     variation       71
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:971495394"
     variation       72
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917347423"
     variation       73
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338475580"
     variation       75
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1399523214"
     variation       76
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577572299"
     variation       77
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556085244"
     variation       78
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278279243"
     variation       80..85
                     /gene="LINC00491"
                     /replace="gcgc"
                     /replace="gcgcgc"
                     /db_xref="dbSNP:1476150517"
     variation       80
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313166415"
     variation       81
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309607623"
     variation       82
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434090075"
     variation       83
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563304229"
     variation       84
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958801271"
     variation       86
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745509092"
     variation       87
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409050547"
     variation       88
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:982846183"
     variation       89
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951470356"
     variation       91
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034842399"
     variation       93
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298954485"
     variation       94
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003790480"
     variation       96
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189814426"
     variation       98
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019900406"
     variation       99
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998299772"
     variation       100
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544741974"
     variation       103
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969299395"
     variation       104
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900902174"
     variation       106
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223979886"
     variation       107
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217994738"
     variation       113
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1023987897"
     variation       115
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577338489"
     variation       116
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245806927"
     variation       117
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267578510"
     variation       119
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:893457255"
     variation       122..123
                     /gene="LINC00491"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1329750932"
     variation       123
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438937872"
     variation       125
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370198621"
     variation       127
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919540468"
     variation       129
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1036348327"
     variation       133
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217432988"
     variation       134
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780865696"
     variation       135
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1366578973"
     variation       136
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756763528"
     variation       140
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890241550"
     variation       142
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281808992"
     variation       147
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051231903"
     variation       148
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934158930"
     variation       152
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288690469"
     variation       155
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451894097"
     variation       157
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958526866"
     variation       162
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552675720"
     variation       163
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376273848"
     variation       165
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534492051"
     variation       168
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941616937"
     variation       171
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751582047"
     variation       172
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909870456"
     variation       173
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457352024"
     variation       174
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3114587"
     variation       175
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997849044"
     variation       177
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965429469"
     variation       178
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930006460"
     variation       182
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928047277"
     variation       185
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331430568"
     variation       187
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339289379"
     variation       188
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1445172644"
     variation       189
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426235298"
     variation       194
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017999722"
     variation       197
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255794557"
     variation       198
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981939377"
     variation       199
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199099270"
     variation       200..202
                     /gene="LINC00491"
                     /replace="cgg"
                     /replace="gga"
                     /db_xref="dbSNP:796805507"
     variation       200
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969645827"
     variation       201
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3105473"
     variation       202
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898069452"
     variation       205
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423239283"
     variation       210
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254354264"
     variation       214..215
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1170077959"
     variation       215
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466460730"
     variation       216
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400525903"
     variation       217
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:989792798"
     variation       219
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311535803"
     variation       221..225
                     /gene="LINC00491"
                     /replace=""
                     /replace="atctt"
                     /db_xref="dbSNP:1275889685"
     variation       224
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301712271"
     variation       226
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:957983706"
     variation       227
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191360414"
     variation       230
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1362545600"
     variation       231
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569912623"
     variation       234
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172310843"
     variation       235
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950059414"
     variation       236
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890168078"
     exon            239..387
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       245
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473103100"
     variation       247
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414686392"
     variation       257
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921682663"
     variation       258
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189675162"
     variation       265
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759554326"
     variation       266
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364978433"
     variation       267
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357711914"
     variation       290
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436252769"
     variation       291
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477847478"
     variation       293
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1366021978"
     variation       294..296
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1216978079"
     variation       298
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:975604301"
     variation       301
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894543207"
     variation       302
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962884700"
     variation       303
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312441346"
     variation       310
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033136027"
     variation       316
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76014588"
     variation       318
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463612061"
     variation       328
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266096668"
     variation       330
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3114607"
     variation       331
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190708861"
     variation       346
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539711542"
     variation       347
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425916112"
     variation       354
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329540122"
     variation       358
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866396044"
     variation       361
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308940814"
     variation       366
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77792830"
     variation       371
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034993572"
     variation       377
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547722279"
     variation       380
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274909661"
     variation       386
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768900141"
     exon            388..1662
                     /gene="LINC00491"
                     /inference="alignment:Splign:2.1.0"
     variation       392
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938821816"
     variation       395
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310791920"
     variation       399
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029714140"
     variation       408
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561532874"
     variation       410
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977277774"
     variation       422
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290091051"
     variation       425
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963911643"
     variation       428
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323319499"
     variation       435
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196497055"
     variation       436
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445931186"
     variation       449
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237547879"
     variation       458
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458149512"
     variation       459
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1018087745"
     variation       466
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180662545"
     variation       477
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401010161"
     variation       480
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235811498"
     variation       492
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044260691"
     variation       498
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947258897"
     variation       499
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416176826"
     variation       500
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005412501"
     variation       502
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1408611532"
     variation       505..506
                     /gene="LINC00491"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1170379936"
     variation       520
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401731886"
     variation       523
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561063618"
     variation       526
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449641847"
     variation       531
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888335554"
     variation       546..547
                     /gene="LINC00491"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1338219392"
     variation       547
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025536341"
     variation       549
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182534989"
     variation       550
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988769251"
     variation       564
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380862281"
     variation       576
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:906224959"
     variation       577
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216635662"
     variation       586
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046144547"
     variation       591..593
                     /gene="LINC00491"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1318251356"
     variation       601
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771704250"
     variation       603
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:986916438"
     variation       608
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947819220"
     variation       612
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953803955"
     variation       616
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163426909"
     variation       618
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1476955246"
     variation       624
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193475425"
     variation       630
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473591708"
     variation       633
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894628195"
     variation       637
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029087457"
     variation       640
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467469853"
     variation       647
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747637941"
     variation       655
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370906737"
     variation       656
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402084143"
     variation       657
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974899253"
     variation       659
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778973212"
     variation       661
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192742199"
     variation       663..665
                     /gene="LINC00491"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1360608293"
     variation       666
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926156268"
     variation       668
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458603870"
     variation       669
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240499523"
     variation       672
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977679127"
     variation       685
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016913818"
     variation       686
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277116142"
     variation       695
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946063512"
     variation       696
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005165853"
     variation       709..710
                     /gene="LINC00491"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1220195521"
     variation       713
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273045919"
     variation       714
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1344186995"
     variation       721
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1201162416"
     variation       724
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922636006"
     variation       727
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280819055"
     variation       729
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487308661"
     variation       733
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216175546"
     variation       734
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264126509"
     variation       744
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545278073"
     variation       749
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561532764"
     variation       753
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451347826"
     variation       761
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377616847"
     variation       763
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574366566"
     variation       767
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:552912109"
     variation       770
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230213057"
     variation       773
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035699599"
     variation       776
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297233703"
     variation       784
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72781850"
     variation       794
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911321038"
     variation       796
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905961410"
     variation       803
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321320592"
     variation       813
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983897286"
     variation       814
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753740225"
     variation       838
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241041758"
     variation       839
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233880946"
     variation       846
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276480217"
     variation       848
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351644624"
     variation       851
                     /gene="LINC00491"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1287073494"
     variation       851
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114522914"
     variation       855
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535054006"
     variation       856
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281152176"
     variation       857
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370692425"
     variation       861
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994530856"
     variation       862
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567632258"
     variation       865
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053437642"
     variation       874
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934598149"
     variation       875
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1378962261"
     variation       880
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025088456"
     variation       881..900
                     /gene="LINC00491"
                     /replace=""
                     /replace="tgagttcattagtcagaaaa"
                     /db_xref="dbSNP:1358307067"
     variation       881
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555804389"
     variation       883..918
                     /gene="LINC00491"
                     /replace=""
                     /replace="agttcattagtcagaaaaagggaaaataccaccacc"
                     /db_xref="dbSNP:1026486700"
     variation       895
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1161026103"
     variation       897
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1011925803"
     variation       903..918
                     /gene="LINC00491"
                     /replace=""
                     /replace="ggaaaataccaccacc"
                     /db_xref="dbSNP:1439714456"
     variation       905..908
                     /gene="LINC00491"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1157681358"
     variation       911
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537165543"
     variation       932
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920993507"
     variation       938
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973820772"
     variation       941
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446212721"
     variation       942
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310074927"
     variation       945
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:963504148"
     variation       953
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79439168"
     variation       962
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189945856"
     variation       977
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984072856"
     variation       979
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757429098"
     variation       982
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457700051"
     variation       983
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478012575"
     variation       994
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177536371"
     variation       998
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1247637257"
     variation       999
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951007140"
     variation       1008
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420289212"
     variation       1021
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1162281237"
     variation       1027
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141837376"
     variation       1047
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458268051"
     variation       1057..1061
                     /gene="LINC00491"
                     /replace=""
                     /replace="acata"
                     /db_xref="dbSNP:1398112179"
     variation       1061
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533436827"
     variation       1062
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465044683"
     variation       1065
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7723461"
     variation       1067
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904727875"
     variation       1069
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041991126"
     variation       1073
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312326878"
     variation       1074
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188560442"
     variation       1077
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256553749"
     variation       1085
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317602683"
     variation       1088..1089
                     /gene="LINC00491"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1276625480"
     variation       1093
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199833757"
     variation       1104
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260492509"
     variation       1105
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7723320"
     variation       1110
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179589806"
     variation       1111
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041415255"
     variation       1112
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868573996"
     variation       1114
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255117963"
     variation       1115
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424028749"
     variation       1122
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1189540974"
     variation       1126
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942736718"
     variation       1128
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421227529"
     variation       1129
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:911268399"
     variation       1142
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370267671"
     variation       1143
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139987955"
     variation       1148
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356173407"
     variation       1153
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338164463"
     variation       1155
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302321051"
     variation       1159
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3105485"
     variation       1161
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416857237"
     variation       1162
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892920752"
     variation       1165
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276470908"
     variation       1166
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340317454"
     variation       1170
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952544002"
     variation       1174
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219585904"
     variation       1178
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487063798"
     variation       1185
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918443329"
     variation       1190
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052965513"
     variation       1193
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569394714"
     variation       1196
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1173407550"
     variation       1198
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414392176"
     variation       1202
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426562316"
     variation       1204..1210
                     /gene="LINC00491"
                     /replace="aaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:891061516"
     variation       1204
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183558415"
     variation       1206
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1477010925"
     variation       1219
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487863559"
     variation       1220
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194086754"
     variation       1221
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:971020335"
     variation       1230
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765800602"
     variation       1237
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537936462"
     variation       1254
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563472919"
     variation       1258
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012284962"
     variation       1259
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545267367"
     variation       1260
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194605319"
     variation       1266
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1486994166"
     variation       1270
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175190424"
     variation       1275
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254308230"
     variation       1276
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762987732"
     variation       1277
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296612883"
     variation       1283
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1032087113"
     variation       1290
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000658022"
     variation       1297
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373533926"
     variation       1301
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551032940"
     variation       1302
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225298678"
     variation       1312
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315792725"
     variation       1314
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277375761"
     variation       1323
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400207049"
     variation       1327
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363714043"
     variation       1331
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920961053"
     variation       1332
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302526228"
     variation       1337
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348016856"
     variation       1339..1342
                     /gene="LINC00491"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1283497928"
     variation       1340
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235813039"
     variation       1346
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038080705"
     variation       1348
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042309976"
     variation       1351
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010419736"
     variation       1352
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243637891"
     variation       1355
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487348112"
     variation       1356
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192225692"
     variation       1358
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983652873"
     variation       1361
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765683622"
     variation       1362
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112722049"
     variation       1369
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911260158"
     variation       1371
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420547324"
     variation       1372
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048443365"
     variation       1373
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529590716"
     variation       1374
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348525268"
     variation       1378
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1436159119"
     variation       1389..1394
                     /gene="LINC00491"
                     /replace="tt"
                     /replace="tttctt"
                     /db_xref="dbSNP:756980392"
     variation       1392
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294674171"
     variation       1394
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573945787"
     variation       1398
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760047014"
     variation       1400
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352250954"
     variation       1404
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224005909"
     variation       1405
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972954818"
     variation       1407
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285853194"
     variation       1415
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319732757"
     variation       1419
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555343945"
     variation       1422
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220513760"
     variation       1436
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1430508085"
     variation       1444
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56170429"
     variation       1446
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187388775"
     variation       1450
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237663539"
     variation       1455
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116239642"
     variation       1456
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959025549"
     variation       1464
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411860473"
     variation       1466
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760472655"
     variation       1483
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050960697"
     variation       1485
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77026938"
     variation       1502
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205451867"
     variation       1503
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331194350"
     variation       1513
                     /gene="LINC00491"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1561532489"
     variation       1513
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375542608"
     variation       1516
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442243976"
     variation       1525
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566161685"
     variation       1526
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:60284576"
     variation       1527
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747684484"
     variation       1529
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010782778"
     variation       1534
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372808956"
     variation       1536
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182199550"
     variation       1540
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020282343"
     variation       1543
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196701183"
     variation       1547
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038010507"
     variation       1553
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567208956"
     variation       1557
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047277231"
     variation       1562..1566
                     /gene="LINC00491"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1310060746"
     variation       1563..1570
                     /gene="LINC00491"
                     /replace="aga"
                     /replace="agaacaga"
                     /db_xref="dbSNP:1220701531"
     variation       1564
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472588800"
     variation       1568
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188839246"
     variation       1574
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420489315"
     variation       1579
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929478809"
     variation       1586
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928830831"
     variation       1588
                     /gene="LINC00491"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:889769244"
     variation       1589
                     /gene="LINC00491"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048350557"
     variation       1591
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931331266"
     variation       1597
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330292135"
     variation       1598..1604
                     /gene="LINC00491"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1356870487"
     variation       1606
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897191537"
     variation       1607
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149498756"
     variation       1614
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990166576"
     variation       1628
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216535965"
     variation       1632
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957624056"
     variation       1635
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530616133"
     variation       1636..1638
                     /gene="LINC00491"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1339980026"
     variation       1648
                     /gene="LINC00491"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332454253"
     variation       1652
                     /gene="LINC00491"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031741670"
     variation       1654..1655
                     /gene="LINC00491"
                     /replace=""
                     /replace="atgcaaaaagtgc"
                     /db_xref="dbSNP:1197783780"
     variation       1655
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202060431"
     variation       1656..1657
                     /gene="LINC00491"
                     /replace=""
                     /replace="ctttttgcatcaa"
                     /db_xref="dbSNP:1554082265"
     variation       1656..1657
                     /gene="LINC00491"
                     /replace="ca"
                     /replace="cactttttgcatca"
                     /replace="cactttttgcgtca"
                     /db_xref="dbSNP:59087646"
     variation       1656
                     /gene="LINC00491"
                     /replace="c"
                     /replace="ctctttttgcatc"
                     /db_xref="dbSNP:1463799317"
     variation       1658
                     /gene="LINC00491"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201159036"
     variation       1659
                     /gene="LINC00491"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200023150"
ORIGIN      
gactcggaaagggaactccctgaccccttgcgcttcccgagtgaggcaatgcctcgccctgcttcgactcgcgcatggtgcgcgcacgcactgacctgcgcccactgtctggcactccctagtgagatgaacccggtacctcagatggaaatgcagaaatcaccagtcttctgcgtcgctcacgctgggagctgtagaccggagctgttcctattcggccatcttgtctcctcccgtgttttccaggtgtattccacattgtctctactagtgaactaggataatccattgtgtatctcaacctccttcactaccctgtgaaagtcacatgtgagaagaagcatcacagatgattccatggagaacatcctggaagttctccaaatgaactggaaattccctgtctccccttaaccagcactggaagcagatgggaagagaatagctgtgactgactcacactctaacccagcaaccctcagcatacaagtgggagaccataaagtttttcaagaccccaaaagaggccaaaggtctgataattgctgggagaaggtccactatccaagaagagaagaggaaaaggaattaaagtctccaagcactggggatgcaagaagagagttgcacaggagagaaagaagaagttgtccacggggtgaccctgcaattggagggaaatgcatgtggatatgtgcagggagtctaggaagtgaagccttagtgatcatttacaagaatgagggttaggtaaaataagggatgcaaagccacctgtagtctattctaacctcactccatcactctatacaatctgtgttttatcatctgaaatgttaagtaaagacctgtttgggtcttcttcagaatcccatacatttgagttcattagtcagaaaaagggaaaataccaccaccccatcctggaatggcagtcatgtacacttttataatgagagattgggcagcaaagggggccccttgtggacctcacccagccagagaaggaggcagaatgtttcctttactatcttttcctctccccagaggaacactacatattgttccctccatgggcttaagagaaggtgccagggttacagatagatatatcgctagctgtagagcacagggtgaattgggatgtccatgtacaaagctagggacaggagaatcagtttaaagactttaaaaataattaggaaaaaaaggaaggcctgacccaaagcttaggagtgcaggtagagaagagatggtgccatgatataccatgtctctgggacttttctgtattcctcttcctctgtatactgtattgccctcattccctatttattcaaaatctgtgctacctccactgcgaagacttccacgagaaaattcagatatttcttcttttgtggacactttctaccttacaaataagttaattttaattcaaggaagagtttttccggaaccctgttggcctgctcacaggaatgtaagttccttaaatctagggcacagtgtctttgagaactgcaatcacctacatcaacatgacatagctattaggactaagaacagagaccacctgtgtcaacatgagttactatttttttccgtgaaacatttgtccaagaaagataagactgtaaccaataaatagtttgcaagtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]