GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:28:38, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_073494               1058 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens SUZ RNA binding domain containing 1 pseudogene
            (LOC100130075), non-coding RNA.
ACCESSION   NR_073494
VERSION     NR_073494.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1058)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC025423.32.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1058              AC025423.32        143984-145041
FEATURES             Location/Qualifiers
     source          1..1058
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q15"
     gene            1..1058
                     /gene="LOC100130075"
                     /note="SUZ RNA binding domain containing 1 pseudogene"
                     /pseudo
                     /db_xref="GeneID:100130075"
     misc_RNA        1..1058
                     /gene="LOC100130075"
                     /product="SUZ RNA binding domain containing 1 pseudogene"
                     /pseudo
                     /db_xref="GeneID:100130075"
     exon            1..1058
                     /gene="LOC100130075"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       8
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318169741"
     variation       9
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328778860"
     variation       11
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537529473"
     variation       17
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970298971"
     variation       19
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981885104"
     variation       21
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024977434"
     variation       23
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969141060"
     variation       37
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916059578"
     variation       39
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279421988"
     variation       40
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317302811"
     variation       43
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570189484"
     variation       46
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1275191499"
     variation       51
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886595468"
     variation       56
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164263953"
     variation       60
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266384055"
     variation       65
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047535787"
     variation       66
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1459882612"
     variation       68
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2120742"
     variation       73
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898844814"
     variation       80
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167898064"
     variation       82
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765592385"
     variation       84..91
                     /gene="LOC100130075"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:1164133386"
     variation       87
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038686068"
     variation       88
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458077927"
     variation       90
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:571564425"
     variation       98
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1388979777"
     variation       110
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429230136"
     variation       113
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250079230"
     variation       114
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186923027"
     variation       127
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80294346"
     variation       133
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977446805"
     variation       149..155
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="aggatga"
                     /db_xref="dbSNP:1340439110"
     variation       156
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533590749"
     variation       162
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018913199"
     variation       163..167
                     /gene="LOC100130075"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1263932070"
     variation       167
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322454056"
     variation       168
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008912977"
     variation       171
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911851296"
     variation       172
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:566717347"
     variation       176
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1263704098"
     variation       183
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487917586"
     variation       184
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354142910"
     variation       188
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1257601628"
     variation       193
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889200861"
     variation       196
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264838263"
     variation       197
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028748899"
     variation       200
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548189692"
     variation       206
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1455078121"
     variation       213
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159627254"
     variation       214
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899077690"
     variation       220
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193148015"
     variation       236
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957421182"
     variation       238
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371350699"
     variation       239
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11177379"
     variation       241
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379936098"
     variation       242
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940354722"
     variation       249
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906170735"
     variation       261
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:980169272"
     variation       265
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337737981"
     variation       267
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7969876"
     variation       270
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286447240"
     variation       275
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:947747679"
     variation       277
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214312450"
     variation       281..282
                     /gene="LOC100130075"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1565728141"
     variation       285
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550829237"
     variation       286
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916344011"
     variation       291
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199375698"
     variation       293
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1014903579"
     variation       294
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950932556"
     variation       299
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026456283"
     variation       301
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994597009"
     variation       304
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:898875805"
     variation       307..310
                     /gene="LOC100130075"
                     /replace="cgga"
                     /replace="cggacgga"
                     /db_xref="dbSNP:560248000"
     variation       307
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148797200"
     variation       308
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:890103935"
     variation       310
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565728130"
     variation       314
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398777677"
     variation       315
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936207033"
     variation       319
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449077003"
     variation       320
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1447737823"
     variation       322
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378478097"
     variation       327
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1051708245"
     variation       328
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:945260865"
     variation       329
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926208001"
     variation       330
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312698699"
     variation       339
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1209385943"
     variation       342
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892310845"
     variation       343
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187723386"
     variation       348
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565728113"
     variation       351
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053515355"
     variation       353
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759181385"
     variation       358
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:926075869"
     variation       359
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200698541"
     variation       374
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967621200"
     variation       376
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1449689179"
     variation       382
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773929486"
     variation       390
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174605213"
     variation       396
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552536374"
     variation       397
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425820552"
     variation       404
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771003227"
     variation       410
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:953455534"
     variation       414
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527696075"
     variation       427
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948774867"
     variation       437
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777460265"
     variation       439
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370918383"
     variation       450
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183002082"
     variation       452..454
                     /gene="LOC100130075"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1368100939"
     variation       454
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866525879"
     variation       455
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1295040858"
     variation       463
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200489144"
     variation       466
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1319303146"
     variation       470
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005186127"
     variation       473
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:906452958"
     variation       476
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879133381"
     variation       482
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218723225"
     variation       490
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256927701"
     variation       491
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769670746"
     variation       493
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223365796"
     variation       496
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:950910830"
     variation       498
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026487500"
     variation       505
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189920669"
     variation       510..511
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1478470179"
     variation       510
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265996098"
     variation       512
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190409327"
     variation       514
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421630008"
     variation       515
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947737881"
     variation       520..521
                     /gene="LOC100130075"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1435503934"
     variation       521
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350210853"
     variation       524
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301153691"
     variation       528
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562717412"
     variation       529
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400605657"
     variation       533
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:894895168"
     variation       538
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315577841"
     variation       541
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229639443"
     variation       542
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114307899"
     variation       546
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576518990"
     variation       551
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321442686"
     variation       554
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329724673"
     variation       558
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558377253"
     variation       560
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781536537"
     variation       563
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187268101"
     variation       564
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473834321"
     variation       568
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182596751"
     variation       574
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413362138"
     variation       582
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403870950"
     variation       583
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1161432420"
     variation       589
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362259624"
     variation       590
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572771645"
     variation       596
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755190922"
     variation       602
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1306240749"
     variation       604
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429236847"
     variation       617
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183055447"
     variation       620
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987430979"
     variation       621
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243368525"
     variation       626
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311889770"
     variation       630
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892424842"
     variation       632..664
                     /gene="LOC100130075"
                     /replace="cactgtgacct"
                     /replace="cactgtgaccttgaatcccatgcactgtgacct"
                     /db_xref="dbSNP:934514288"
     variation       633
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:529150425"
     variation       643
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569203555"
     variation       644
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1144941"
     variation       650
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210892961"
     variation       651
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115045775"
     variation       656
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963514722"
     variation       657
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780053379"
     variation       658
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004728393"
     variation       666
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440084910"
     variation       668
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917265139"
     variation       669
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561450950"
     variation       670
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993199145"
     variation       673..680
                     /gene="LOC100130075"
                     /replace="ctcct"
                     /replace="ctcctcct"
                     /db_xref="dbSNP:1378021850"
     variation       673
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473516713"
     variation       675
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334213145"
     variation       676
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358121887"
     variation       678..679
                     /gene="LOC100130075"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1249575373"
     variation       678
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970625080"
     variation       681
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919542223"
     variation       689..694
                     /gene="LOC100130075"
                     /replace="tg"
                     /replace="tgattg"
                     /db_xref="dbSNP:1278205322"
     variation       696
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347748881"
     variation       701
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144405813"
     variation       709
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277969944"
     variation       725
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011903671"
     variation       733
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552395981"
     variation       739
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200713243"
     variation       760..765
                     /gene="LOC100130075"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1565728027"
     variation       764
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280227180"
     variation       765
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239035040"
     variation       767
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:879206990"
     variation       772
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469611017"
     variation       773
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177774116"
     variation       775
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018165269"
     variation       787..792
                     /gene="LOC100130075"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1565728022"
     variation       791..796
                     /gene="LOC100130075"
                     /replace="ag"
                     /replace="agtcag"
                     /db_xref="dbSNP:541644729"
     variation       794..800
                     /gene="LOC100130075"
                     /replace="cag"
                     /replace="cagacag"
                     /db_xref="dbSNP:1565728020"
     variation       794
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985910169"
     variation       801
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173113626"
     variation       803..804
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1423809230"
     variation       818
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527659751"
     variation       823
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1053470888"
     variation       826
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565728018"
     variation       827
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541127949"
     variation       847..851
                     /gene="LOC100130075"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:1343937378"
     variation       859
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400553719"
     variation       860
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255758929"
     variation       865
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029998806"
     variation       866
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333235879"
     variation       875
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437744402"
     variation       879
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000982627"
     variation       884
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220532402"
     variation       885
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902266321"
     variation       895..899
                     /gene="LOC100130075"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1565728009"
     variation       914..921
                     /gene="LOC100130075"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:202102871"
     variation       919..926
                     /gene="LOC100130075"
                     /replace="aaag"
                     /replace="aaagaaag"
                     /db_xref="dbSNP:779479826"
     variation       925
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352837042"
     variation       934
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194342226"
     variation       943
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287039057"
     variation       951
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:566771319"
     variation       981
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191255350"
     variation       983
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032245717"
     variation       1003
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1246065186"
     variation       1006
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549961689"
     variation       1010
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336332991"
     variation       1011
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412966389"
     variation       1017
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479447175"
     variation       1023
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:912127347"
     variation       1032
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172181654"
     variation       1047
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:530323227"
     variation       1052
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1051995753"
     variation       1054
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401823247"
ORIGIN      
ggaaagtggcgagtaagatggaatatgaggaggttgctgagagctgggaggagacggcagacagcggggaaatagacgtctggaaaaaaaactgaagatcacacagaaagcaggaaattcaaatctcccaaagtgcccattgtgattcaggatgataattttcccccgggaccccctccacaggtccgcatcctcaagaggcccaccagcaacggtgtggtcagcagccccaagtccgctagcaggcccgcccttccagtcaagtccctggcacagtgggaagccgagtacaccgaggccaggaagcggatcctgggcagcgccaacccgaggagaagcaggagaaacccatcctcgataggtcttcctctgatcttcttcccttcaggccaaccaggatctcctaacccgaagacagcagacagcccaataatgtgatcagacagcctctgggtcctgatgggtcacacggcttcaaacagcgcagataaatgcaggcaagaagagatggcgcgactgccgcgtcaacgcgtcctgggtcgtccgccaagggttgcactaccgtggcagacagctggacttgagcagcgggaacttgacttacttgcctggtgatccccgttgctccgcccactgtgaccttgaatcccatgcactgtgacctccccccttctcctccttcccactgtgattggcactttgacaaggactgtcccaagtcaatggaaagggaaaaagggtgagggttaggagaaggttggggggaacccaccaattactcagagtagagagtcagacagggccagcaatagcggtttatcatgctcattaatttgggatttcaaaacacaaatgaactcacacctacccacccccaagtgcatgtcatcacttaaaaagtgagttccatttgaaaaaaaagaaagcaaactacctgctcactctaaaagcagttgctgttgtttgtgactttgccatttaaaaaaatacagaccagctgctgctgtttgcttgcattccacagttatcttgtgtcactttgccctttgttgtgctta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]