GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 08:59:35, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NR_070329                133 bp    RNA     linear   INV 15-AUG-2018
DEFINITION  Caenorhabditis elegans Unclassified non-coding RNA ZK1193.9
            (ZK1193.9), ncRNA.
ACCESSION   NR_070329
VERSION     NR_070329.1
DBLINK      BioProject: PRJNA158
            BioSample: SAMEA3138177
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis.
REFERENCE   1  (bases 1 to 133)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 133)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-AUG-2018) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 133)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (24-JUL-2018) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 133)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003284).
FEATURES             Location/Qualifiers
     source          1..133
                     /organism="Caenorhabditis elegans"
                     /mol_type="transcribed RNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="X"
     gene            1..133
                     /gene="ZK1193.9"
                     /locus_tag="CELE_ZK1193.9"
                     /db_xref="GeneID:13219061"
     ncRNA           1..133
                     /ncRNA_class="other"
                     /gene="ZK1193.9"
                     /locus_tag="CELE_ZK1193.9"
                     /product="Unclassified non-coding RNA ZK1193.9"
                     /standard_name="ZK1193.9"
                     /db_xref="GeneID:13219061"
ORIGIN      
gaaggcgaccacgtcgtcgccaagaagagattgaagacgacgaatggagcgaaagtagtaaggaggggttgagggggggggaggtcgggatcgagatggcataatgtaggaaccggatggaagagtctaaaag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]