ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-22 22:35:25, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_049829 112 bp RNA linear PRI 08-SEP-2020
DEFINITION Homo sapiens microRNA 5197 (MIR5197), microRNA.
ACCESSION NR_049829
VERSION NR_049829.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 112)
AUTHORS Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken
WF, Pieters R and den Boer ML.
TITLE Discovery of new microRNAs by small RNAome deep sequencing in
childhood acute lymphoblastic leukemia
JOURNAL Leukemia 25 (9), 1389-1399 (2011)
PUBMED 21606961
REMARK Review article
REFERENCE 2 (bases 1 to 112)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC008696.6.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-112 AC008696.6 125814-125925 c
FEATURES Location/Qualifiers
source 1..112
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="5"
/map="5q31.3"
gene 1..112
/gene="MIR5197"
/note="microRNA 5197"
/db_xref="GeneID:100846991"
/db_xref="HGNC:HGNC:43450"
/db_xref="miRBase:MI0018176"
precursor_RNA 1..112
/gene="MIR5197"
/product="microRNA 5197"
/db_xref="GeneID:100846991"
/db_xref="HGNC:HGNC:43450"
/db_xref="miRBase:MI0018176"
exon 1..112
/gene="MIR5197"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1489960847"
variation 3
/gene="MIR5197"
/replace=""
/replace="t"
/db_xref="dbSNP:1757695667"
variation 4..6
/gene="MIR5197"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:35579612"
variation 6
/gene="MIR5197"
/replace="g"
/replace="t"
/db_xref="dbSNP:1298572672"
variation 9
/gene="MIR5197"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:2042253"
variation 12
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229081286"
variation 13
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1757696027"
variation 18
/gene="MIR5197"
/replace="a"
/replace="t"
/db_xref="dbSNP:1580928229"
variation 21
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:1561903822"
variation 22
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:1757696184"
variation 23
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:553711864"
ncRNA 27..49
/ncRNA_class="miRNA"
/gene="MIR5197"
/product="hsa-miR-5197-5p"
/db_xref="miRBase:MIMAT0021130"
/db_xref="GeneID:100846991"
/db_xref="HGNC:HGNC:43450"
/db_xref="miRBase:MI0018176"
variation 28
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:934588813"
variation 30
/gene="MIR5197"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277438133"
variation 32
/gene="MIR5197"
/replace="g"
/replace="t"
/db_xref="dbSNP:757874166"
variation 37
/gene="MIR5197"
/replace="a"
/replace="c"
/db_xref="dbSNP:1757696514"
variation 38
/gene="MIR5197"
/replace="a"
/replace="t"
/db_xref="dbSNP:546634101"
variation 39
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1358766411"
variation 40
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1277811118"
variation 41
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1227864408"
variation 42
/gene="MIR5197"
/replace="a"
/replace="c"
/db_xref="dbSNP:2126720389"
variation 45
/gene="MIR5197"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:372758014"
variation 57
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:970099591"
variation 58
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:2479829516"
variation 59
/gene="MIR5197"
/replace="a"
/replace="t"
/db_xref="dbSNP:1757696950"
variation 60
/gene="MIR5197"
/replace="c"
/replace="g"
/db_xref="dbSNP:1757697010"
variation 63
/gene="MIR5197"
/replace="c"
/replace="g"
/db_xref="dbSNP:2126720398"
ncRNA 64..86
/ncRNA_class="miRNA"
/gene="MIR5197"
/product="hsa-miR-5197-3p"
/db_xref="miRBase:MIMAT0021131"
/db_xref="GeneID:100846991"
/db_xref="HGNC:HGNC:43450"
/db_xref="miRBase:MI0018176"
variation 68
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:2126720401"
variation 71
/gene="MIR5197"
/replace="g"
/replace="t"
/db_xref="dbSNP:77549240"
variation 73
/gene="MIR5197"
/replace="a"
/replace="c"
/db_xref="dbSNP:1411653302"
variation 77
/gene="MIR5197"
/replace="c"
/replace="g"
/db_xref="dbSNP:1347866830"
variation 82
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:892818585"
variation 83
/gene="MIR5197"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1405555825"
variation 87
/gene="MIR5197"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:920738919"
variation 89
/gene="MIR5197"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1454576100"
variation 94
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:1757698122"
variation 95
/gene="MIR5197"
/replace="a"
/replace="t"
/db_xref="dbSNP:1175313611"
variation 96
/gene="MIR5197"
/replace="a"
/replace="g"
/db_xref="dbSNP:1757698238"
variation 97
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1757698293"
variation 105
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1412154067"
variation 106
/gene="MIR5197"
/replace="c"
/replace="t"
/db_xref="dbSNP:1184932024"
variation 108
/gene="MIR5197"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1757698447"
variation 111
/gene="MIR5197"
/replace="c"
/replace="g"
/db_xref="dbSNP:1757698529"
ORIGIN
tatgggattccacagacaatgagtatcaatggcacaaactcattcttgaatttttgccagttcaagaagagactgagtcatcgaatgctctaaatgtcacttcacctcatgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]