2025-07-02 11:56:50, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_049460 70 bp RNA linear MAM 04-FEB-2021 DEFINITION Canis lupus familiaris microRNA mir-375 (MIR375), microRNA. ACCESSION NR_049460 VERSION NR_049460.1 KEYWORDS RefSeq. SOURCE Canis lupus familiaris (dog) ORGANISM Canis lupus familiaris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Canis. REFERENCE 1 (bases 1 to 70) AUTHORS Artzi S, Kiezun A and Shomron N. TITLE miRNAminer: a tool for homologous microRNA gene search JOURNAL BMC Bioinformatics 9, 39 (2008) PUBMED 18215311 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 70) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JAAUVH010000368.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-70 JAAUVH010000368.1 25583487-25583556 c FEATURES Location/Qualifiers source 1..70 /organism="Canis lupus familiaris" /mol_type="transcribed RNA" /sub_species="familiaris" /db_xref="taxon:9615" /chromosome="37" /map="37" /breed="Labrador retriever" gene 1..70 /gene="MIR375" /gene_synonym="cfa-mir-375" /note="microRNA mir-375" /db_xref="GeneID:100886000" /db_xref="miRBase:MI0010368" precursor_RNA 1..70 /gene="MIR375" /gene_synonym="cfa-mir-375" /product="microRNA mir-375" /db_xref="GeneID:100886000" /db_xref="miRBase:MI0010368" exon 1..70 /gene="MIR375" /gene_synonym="cfa-mir-375" /inference="alignment:Splign:2.1.0" ncRNA 41..62 /ncRNA_class="miRNA" /gene="MIR375" /gene_synonym="cfa-mir-375" /product="cfa-miR-375" /db_xref="miRBase:MIMAT0009871" /db_xref="GeneID:100886000" /db_xref="miRBase:MI0010368" ORIGIN
gccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggcagggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]