GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-23 22:39:25, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_049460                 70 bp    RNA     linear   MAM 04-FEB-2021
DEFINITION  Canis lupus familiaris microRNA mir-375 (MIR375), microRNA.
ACCESSION   NR_049460
VERSION     NR_049460.1
KEYWORDS    RefSeq.
SOURCE      Canis lupus familiaris (dog)
  ORGANISM  Canis lupus familiaris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
            Canis.
REFERENCE   1  (bases 1 to 70)
  AUTHORS   Artzi S, Kiezun A and Shomron N.
  TITLE     miRNAminer: a tool for homologous microRNA gene search
  JOURNAL   BMC Bioinformatics 9, 39 (2008)
   PUBMED   18215311
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 70)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAAUVH010000368.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-70                JAAUVH010000368.1  25583487-25583556   c
FEATURES             Location/Qualifiers
     source          1..70
                     /organism="Canis lupus familiaris"
                     /mol_type="transcribed RNA"
                     /sub_species="familiaris"
                     /db_xref="taxon:9615"
                     /chromosome="37"
                     /map="37"
                     /breed="Labrador retriever"
     gene            1..70
                     /gene="MIR375"
                     /gene_synonym="cfa-mir-375"
                     /note="microRNA mir-375"
                     /db_xref="GeneID:100886000"
                     /db_xref="miRBase:MI0010368"
     precursor_RNA   1..70
                     /gene="MIR375"
                     /gene_synonym="cfa-mir-375"
                     /product="microRNA mir-375"
                     /db_xref="GeneID:100886000"
                     /db_xref="miRBase:MI0010368"
     exon            1..70
                     /gene="MIR375"
                     /gene_synonym="cfa-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           41..62
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="cfa-mir-375"
                     /product="cfa-miR-375"
                     /db_xref="miRBase:MIMAT0009871"
                     /db_xref="GeneID:100886000"
                     /db_xref="miRBase:MI0010368"
ORIGIN      
gccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggcagggg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]