ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-23 22:39:25, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_049460 70 bp RNA linear MAM 04-FEB-2021
DEFINITION Canis lupus familiaris microRNA mir-375 (MIR375), microRNA.
ACCESSION NR_049460
VERSION NR_049460.1
KEYWORDS RefSeq.
SOURCE Canis lupus familiaris (dog)
ORGANISM Canis lupus familiaris
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae;
Canis.
REFERENCE 1 (bases 1 to 70)
AUTHORS Artzi S, Kiezun A and Shomron N.
TITLE miRNAminer: a tool for homologous microRNA gene search
JOURNAL BMC Bioinformatics 9, 39 (2008)
PUBMED 18215311
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 70)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from JAAUVH010000368.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-70 JAAUVH010000368.1 25583487-25583556 c
FEATURES Location/Qualifiers
source 1..70
/organism="Canis lupus familiaris"
/mol_type="transcribed RNA"
/sub_species="familiaris"
/db_xref="taxon:9615"
/chromosome="37"
/map="37"
/breed="Labrador retriever"
gene 1..70
/gene="MIR375"
/gene_synonym="cfa-mir-375"
/note="microRNA mir-375"
/db_xref="GeneID:100886000"
/db_xref="miRBase:MI0010368"
precursor_RNA 1..70
/gene="MIR375"
/gene_synonym="cfa-mir-375"
/product="microRNA mir-375"
/db_xref="GeneID:100886000"
/db_xref="miRBase:MI0010368"
exon 1..70
/gene="MIR375"
/gene_synonym="cfa-mir-375"
/inference="alignment:Splign:2.1.0"
ncRNA 41..62
/ncRNA_class="miRNA"
/gene="MIR375"
/gene_synonym="cfa-mir-375"
/product="cfa-miR-375"
/db_xref="miRBase:MIMAT0009871"
/db_xref="GeneID:100886000"
/db_xref="miRBase:MI0010368"
ORIGIN
gccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggcagggg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]