LOCUS       NR_049106                 72 bp    RNA     linear   VRT 10-MAY-2023
DEFINITION  Taeniopygia guttata microRNA mir-375 (MIR375), microRNA.
ACCESSION   NR_049106
VERSION     NR_049106.1
KEYWORDS    RefSeq.
SOURCE      Taeniopygia guttata (zebra finch)
  ORGANISM  Taeniopygia guttata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Passeroidea;
            Estrildidae; Estrildinae; Taeniopygia.
REFERENCE   1  (bases 1 to 72)
  AUTHORS   Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ and Li
            X.
  TITLE     Genome-wide annotation and analysis of zebra finch microRNA
            repertoire reveal sex-biased expression
  JOURNAL   BMC Genomics 13, 727 (2012)
   PUBMED   23268654
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 72)
  AUTHORS   Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner
            A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L,
            Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris
            M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Lin YC,
            George J, Sweedler J, Southey B, Gunaratne P, Watson M, Nam K,
            Backstrom N, Smeds L, Nabholz B, Itoh Y, Whitney O, Pfenning AR,
            Howard J, Volker M, Skinner BM, Griffin DK, Ye L, McLaren WM,
            Flicek P, Quesada V, Velasco G, Lopez-Otin C, Puente XS, Olender T,
            Lancet D, Smit AF, Hubley R, Konkel MK, Walker JA, Batzer MA, Gu W,
            Pollock DD, Chen L, Cheng Z, Eichler EE, Stapley J, Slate J, Ekblom
            R, Birkhead T, Burke T, Burt D, Scharff C, Adam I, Richard H,
            Sultan M, Soldatov A, Lehrach H, Edwards SV, Yang SP, Li X, Graves
            T, Fulton L, Nelson J, Chinwalla A, Hou S, Mardis ER and Wilson RK.
  TITLE     The genome of a songbird
  JOURNAL   Nature 464 (7289), 757-762 (2010)
   PUBMED   20360741
REFERENCE   3  (bases 1 to 72)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from RRCB02000021.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-72                RRCB02000021.1     10090800-10090871   c
FEATURES             Location/Qualifiers
     source          1..72
                     /organism="Taeniopygia guttata"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:59729"
                     /chromosome="7"
                     /map="7"
     gene            1..72
                     /gene="MIR375"
                     /gene_synonym="tgu-mir-375"
                     /note="microRNA mir-375"
                     /db_xref="GeneID:100886773"
                     /db_xref="miRBase:MI0013798"
     precursor_RNA   1..72
                     /gene="MIR375"
                     /gene_synonym="tgu-mir-375"
                     /product="microRNA mir-375"
                     /db_xref="GeneID:100886773"
                     /db_xref="miRBase:MI0013798"
     exon            1..72
                     /gene="MIR375"
                     /gene_synonym="tgu-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           41..62
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="tgu-mir-375"
                     /product="tgu-miR-375"
                     /db_xref="miRBase:MIMAT0014572"
                     /db_xref="GeneID:100886773"
                     /db_xref="miRBase:MI0013798"
ORIGIN      

cctggcgtcgagccccacgtgcaatacctgacctgaacgttttgttcgttcggctcgcgttaggcaggtcca

//