GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:29:43, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_048536               2603 bp    RNA     linear   PRI 01-MAR-2020
DEFINITION  Homo sapiens long intergenic non-protein coding RNA, regulator of
            reprogramming (LINC-ROR), transcript variant 1, long non-coding
            RNA.
ACCESSION   NR_048536
VERSION     NR_048536.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2603)
  AUTHORS   Ji Z, Chi J, Sun H, Ru A, Ni T, Zhang J, Jiang F, Lv H, Peng F, Guo
            H and Chen Y.
  TITLE     Linc-ROR targets FGF2 to regulate HASMC proliferation and migration
            via sponging miR-195-5p
  JOURNAL   Gene 725, 144143 (2020)
   PUBMED   31629816
  REMARK    GeneRIF: Mechanistic functional studies revealed that linc-ROR
            promoted HASMC proliferation and migration via regulating
            miR-195-5p/FGF2 axis.
REFERENCE   2  (bases 1 to 2603)
  AUTHORS   He X, Yu J, Xiong L, Liu Y, Fan L, Li Y, Chen B, Chen J and Xu X.
  TITLE     Exosomes derived from liver cancer cells reprogram biological
            behaviors of LO2 cells by transferring Linc-ROR
  JOURNAL   Gene 719, 144044 (2019)
   PUBMED   31400406
  REMARK    GeneRIF: Our experiments indicated the HepG2 cells could transfer
            its Linc-ROR to the LO2 cells via exosomes, then influenced the
            recipient cells
REFERENCE   3  (bases 1 to 2603)
  AUTHORS   Shi J, Zhang D, Zhong Z and Zhang W.
  TITLE     lncRNA ROR promotes the progression of renal cell carcinoma through
            the miR206/VEGF axis
  JOURNAL   Mol Med Rep 20 (4), 3782-3792 (2019)
   PUBMED   31485634
  REMARK    GeneRIF: The results of the present study revealed that lincRNA-RoR
            was upregulated in renal cell carcinoma tissues, which promoted
            tumor progression by regulating the miR206/VEGF axis.
REFERENCE   4  (bases 1 to 2603)
  AUTHORS   Toraih EA, El-Wazir A, Hussein MH, Khashana MS, Matter A, Fawzy MS
            and Hosny S.
  TITLE     Expression of long intergenic non-coding RNA, regulator of
            reprogramming, and its prognostic value in patients with
            glioblastoma
  JOURNAL   Int. J. Biol. Markers 34 (1), 69-79 (2019)
   PUBMED   30852975
  REMARK    GeneRIF: High LINC-ROR expression is associated with glioblastoma.
REFERENCE   5  (bases 1 to 2603)
  AUTHORS   Lu R, Chen J, Kong L and Zhu H.
  TITLE     Prognostic value of lncRNA ROR expression in various cancers: a
            meta-analysis
  JOURNAL   Biosci. Rep. 38 (5) (2018)
   PUBMED   30076198
  REMARK    GeneRIF: High lncRNA ROR expression was associated with worse
            prognosis in cancers. [meta-analysis]
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2603)
  AUTHORS   Takahashi K, Yan IK, Haga H and Patel T.
  TITLE     Modulation of hypoxia-signaling pathways by extracellular linc-RoR
  JOURNAL   J. Cell. Sci. 127 (Pt 7), 1585-1594 (2014)
   PUBMED   24463816
REFERENCE   7  (bases 1 to 2603)
  AUTHORS   Cheng EC and Lin H.
  TITLE     Repressing the repressor: a lincRNA as a MicroRNA sponge in
            embryonic stem cell self-renewal
  JOURNAL   Dev. Cell 25 (1), 1-2 (2013)
   PUBMED   23597480
REFERENCE   8  (bases 1 to 2603)
  AUTHORS   Wang Y, Xu Z, Jiang J, Xu C, Kang J, Xiao L, Wu M, Xiong J, Guo X
            and Liu H.
  TITLE     Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2
            in human embryonic stem cell self-renewal
  JOURNAL   Dev. Cell 25 (1), 69-80 (2013)
   PUBMED   23541921
  REMARK    GeneRIF: Linc-RoR expression is positively correlated with the
            undifferentiated embryonic stem cell state.
REFERENCE   9  (bases 1 to 2603)
  AUTHORS   Zhang A, Zhou N, Huang J, Liu Q, Fukuda K, Ma D, Lu Z, Bai C,
            Watabe K and Mo YY.
  TITLE     The human long non-coding RNA-RoR is a p53 repressor in response to
            DNA damage
  JOURNAL   Cell Res. 23 (3), 340-350 (2013)
   PUBMED   23208419
REFERENCE   10 (bases 1 to 2603)
  AUTHORS   Loewer S, Cabili MN, Guttman M, Loh YH, Thomas K, Park IH, Garber
            M, Curran M, Onder T, Agarwal S, Manos PD, Datta S, Lander ES,
            Schlaeger TM, Daley GQ and Rinn JL.
  TITLE     Large intergenic non-coding RNA-RoR modulates reprogramming of
            human induced pluripotent stem cells
  JOURNAL   Nat. Genet. 42 (12), 1113-1117 (2010)
   PUBMED   21057500
  REMARK    Erratum:[Nat Genet. 2010 Dec;42(12): 3 p following 1117]
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from HQ315778.1 and AI340242.1.
            On Dec 16, 2017 this sequence version replaced NR_048536.1.
            
            Summary: This gene produces a long non-coding RNA that regulates
            the reprogramming of pluripotent stem cells. This RNA suppresses
            induction of tumor protein p53 after DNA damage. It is thought to
            act as a sponge for microRNAs that regulate stem cell factors POU
            class 5 homeobox 1, Nanog, and SRY-box 2. This RNA may also have a
            extracellular role in modulating response to hypoxia in
            hepatocellular cancer cells. Expression of this transcript is
            associated with tumor progression and epithelial to mesenchymal
            transition and metastasis. [provided by RefSeq, Dec 2017].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HG975412.1, HQ315778.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2591              HQ315778.1         1-2591
            2592-2603           AI340242.1         1-12                c
FEATURES             Location/Qualifiers
     source          1..2603
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q21.31"
     gene            1..2603
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /note="long intergenic non-protein coding RNA, regulator
                     of reprogramming"
                     /db_xref="GeneID:100885779"
                     /db_xref="HGNC:HGNC:43773"
                     /db_xref="MIM:615173"
     ncRNA           1..2603
                     /ncRNA_class="lncRNA"
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /product="long intergenic non-protein coding RNA,
                     regulator of reprogramming, transcript variant 1"
                     /db_xref="GeneID:100885779"
                     /db_xref="HGNC:HGNC:43773"
                     /db_xref="MIM:615173"
     exon            1..216
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315017665"
     variation       18
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215666891"
     variation       22
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545140740"
     variation       23..36
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ct"
                     /replace="ctcacacaaagcct"
                     /db_xref="dbSNP:1462803840"
     variation       24
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305854970"
     variation       33
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308528201"
     variation       34
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051852791"
     variation       36
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997651449"
     variation       37
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344535048"
     variation       42
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236671466"
     variation       54
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898010617"
     variation       56
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186490309"
     variation       57
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539410766"
     variation       60
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427437411"
     variation       61
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34531088"
     variation       62
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431039109"
     variation       63
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147929336"
     variation       66
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467875554"
     variation       68
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335225248"
     variation       72
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889048467"
     variation       79
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144776454"
     variation       80
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568045900"
     variation       84
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930311575"
     variation       86
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360447869"
     variation       87
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574263862"
     variation       88
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325998788"
     variation       91
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:369566490"
     variation       92
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937082371"
     variation       97
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419745567"
     variation       104
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317300116"
     variation       108..111
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="gaga"
                     /replace="gagaga"
                     /db_xref="dbSNP:745422140"
     variation       108
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949776851"
     variation       109
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:928346264"
     variation       115
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555831650"
     variation       116
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918120402"
     variation       117
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:12455107"
     variation       118
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967154179"
     variation       120
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270408730"
     variation       122
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479287879"
     variation       134..136
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:938137256"
     variation       138
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926882408"
     variation       141
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569926553"
     variation       142
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968491700"
     variation       150
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551430161"
     variation       152
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343987880"
     variation       160
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020945430"
     variation       163
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262403555"
     variation       176
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215966998"
     variation       178
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303895419"
     variation       182
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988214199"
     variation       196
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:966080716"
     variation       200
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374265288"
     variation       205
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225304069"
     variation       208
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913084777"
     variation       215
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990454739"
     exon            217..410
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       217
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200709289"
     variation       219
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251130388"
     variation       225
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192538678"
     variation       227
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159110445"
     variation       231
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74382330"
     variation       232
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926163669"
     variation       233
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240942842"
     variation       234
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390962674"
     variation       235
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387756648"
     variation       237
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369510210"
     variation       240
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572788660"
     variation       241
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318833637"
     variation       242..243
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1260413652"
     variation       243
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979407384"
     variation       248
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345235285"
     variation       252
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377125467"
     variation       264
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381975980"
     variation       265
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920925212"
     variation       269
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538193382"
     variation       270
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965046401"
     variation       271
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331924519"
     variation       273
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983731936"
     variation       281
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180437801"
     variation       290..295
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1300403883"
     variation       294
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368741377"
     variation       295
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459114857"
     variation       298
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229289193"
     variation       306
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568045315"
     variation       310..316
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="tctt"
                     /replace="tcttctt"
                     /db_xref="dbSNP:981864480"
     variation       313
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186682482"
     variation       314
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:527588124"
     variation       315
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376142866"
     variation       316
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952635745"
     variation       317
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026848056"
     variation       321
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291617713"
     variation       324
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558051786"
     variation       325
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539376122"
     variation       326
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023474182"
     variation       334
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297453216"
     variation       338
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427577991"
     variation       339
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256244293"
     variation       340
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424978710"
     variation       345
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391994981"
     variation       346
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182511228"
     variation       349
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1416655784"
     variation       349
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011659024"
     variation       350
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565994970"
     variation       352
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547262594"
     variation       354
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460925848"
     variation       355
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188951776"
     variation       356
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529127279"
     variation       360
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998753561"
     variation       361
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355034795"
     variation       367
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204940936"
     variation       375
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891053912"
     variation       376
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305480293"
     variation       378
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:567815362"
     variation       379
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277148458"
     variation       380
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229822993"
     variation       382
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486382942"
     variation       383
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549471036"
     variation       384
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1256441817"
     variation       386
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488413118"
     variation       389
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187843496"
     variation       390
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282519037"
     variation       392
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170401149"
     variation       407
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:932308796"
     exon            411..911
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       416
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924763755"
     variation       417
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1323039713"
     variation       428
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355018862"
     variation       430
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444346440"
     variation       432
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:909587747"
     variation       434
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984956364"
     variation       443
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952209176"
     variation       447
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2027701"
     variation       448
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356914125"
     variation       449
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300345083"
     variation       452
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1273145540"
     variation       453
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308555034"
     variation       454
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462586526"
     variation       455
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969030873"
     variation       456
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236668785"
     variation       457
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1457603373"
     variation       458
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914810135"
     variation       459
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184665858"
     variation       463
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041959"
     variation       467
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368146527"
     variation       468
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245184108"
     variation       470
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471962389"
     variation       481
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:972027464"
     variation       482
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:4800957"
     variation       491
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963655422"
     variation       509
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560555121"
     variation       510
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1385703843"
     variation       512..519
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="taag"
                     /replace="taagtaag"
                     /db_xref="dbSNP:1338528932"
     variation       522
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338303080"
     variation       523
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446872211"
     variation       526
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180841500"
     variation       529
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748799513"
     variation       531
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417017089"
     variation       535
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220930057"
     variation       541
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256710152"
     variation       543
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568041921"
     variation       546..550
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="cccc"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1204685669"
     variation       546
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1007940708"
     variation       556
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024327261"
     variation       558
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542372643"
     variation       560
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252620519"
     variation       578
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177664113"
     variation       581
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1013293682"
     variation       582
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487903894"
     variation       585
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951204141"
     variation       586
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958852859"
     variation       592
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191685688"
     variation       597..602
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="tga"
                     /replace="tgatga"
                     /db_xref="dbSNP:770832224"
     variation       605
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284791718"
     variation       607
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025511024"
     variation       611
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569378012"
     variation       619
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377049509"
     variation       643
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748268"
     variation       644
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413492345"
     variation       660
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898439248"
     variation       667
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562867137"
     variation       669
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346664209"
     variation       673
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041547021"
     variation       674
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777466175"
     variation       675
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392457583"
     variation       676
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224698843"
     variation       678
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276925833"
     variation       682
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1343330588"
     variation       685
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200024241"
     variation       692
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894447298"
     variation       703
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345009255"
     variation       712
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301364050"
     variation       715
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426567246"
     variation       716
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1568041875"
     variation       722
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366434502"
     variation       724
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158172789"
     variation       730
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057239335"
     variation       748
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262604185"
     variation       783
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480692827"
     variation       788
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938818531"
     variation       789
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201513340"
     variation       793
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776710587"
     variation       794
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477572175"
     variation       800
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1039380881"
     variation       808
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544289708"
     variation       814
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386652967"
     variation       830
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1417524637"
     variation       832
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576240612"
     variation       835
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557813670"
     variation       840
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296999727"
     variation       844..846
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1406028354"
     variation       844
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365685294"
     variation       847
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1326115208"
     variation       848
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041916928"
     variation       852
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189681039"
     variation       855
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182490523"
     variation       859
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232973494"
     variation       861
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777244920"
     variation       867
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1280560083"
     variation       868
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186796068"
     variation       877
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975605138"
     variation       892
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115482094"
     variation       893..896
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="ctcc"
                     /db_xref="dbSNP:1200971572"
     variation       902
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1490534543"
     variation       908
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1490350570"
     exon            912..2603
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /inference="alignment:Splign:2.1.0"
     variation       912
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186224767"
     variation       915
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219199079"
     variation       917
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279795676"
     variation       921
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001730040"
     variation       922
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293800556"
     variation       927
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:939134201"
     variation       934
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226514440"
     variation       938
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568041533"
     variation       939
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429548507"
     variation       940
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345035102"
     variation       950
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927724283"
     variation       951
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256215822"
     variation       956
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904676900"
     variation       982
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043215897"
     variation       984
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256217380"
     variation       985
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6566851"
     variation       989
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195037820"
     variation       999
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6566850"
     variation       1001
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427094202"
     variation       1003
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562584326"
     variation       1005
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176285092"
     variation       1006
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378392112"
     variation       1009
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1467802829"
     variation       1010
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041450572"
     variation       1019
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944045541"
     variation       1030
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479526417"
     variation       1033
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181906570"
     variation       1042..1044
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1192064064"
     variation       1044
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867537510"
     variation       1046
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112391050"
     variation       1047
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367857887"
     variation       1053
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1381421666"
     variation       1055
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919779064"
     variation       1061
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:573557287"
     variation       1064
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972501615"
     variation       1065
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113761454"
     variation       1069
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221585234"
     variation       1074
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911260365"
     variation       1085
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76248969"
     variation       1093
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265946362"
     variation       1094
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138434751"
     variation       1098
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186253464"
     variation       1103
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029728517"
     variation       1104
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117346350"
     variation       1105
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435069819"
     variation       1125
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961535935"
     variation       1126
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172014626"
     variation       1130
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017204021"
     variation       1137
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369923413"
     variation       1140
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150898582"
     variation       1143
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420371937"
     variation       1147
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160587231"
     variation       1155
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033455960"
     variation       1160
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005766220"
     variation       1167
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293836125"
     variation       1171
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437764931"
     variation       1175
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895394295"
     variation       1176
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377241972"
     variation       1181
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033375786"
     variation       1185
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568041465"
     variation       1189
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283297554"
     variation       1190
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315603155"
     variation       1192
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967764965"
     variation       1195
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003194473"
     variation       1198
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021802850"
     variation       1209
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192218233"
     variation       1224
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468698127"
     variation       1228
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361028109"
     variation       1229
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176904693"
     variation       1232
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427929285"
     variation       1236
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:906295350"
     variation       1237
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042110493"
     variation       1239
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418358417"
     variation       1240
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116530811"
     variation       1241
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188460710"
     variation       1243
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:892075390"
     variation       1247
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557551927"
     variation       1248..1251
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1400521598"
     variation       1248
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008668134"
     variation       1259
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448561568"
     variation       1264
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187966071"
     variation       1266
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371989364"
     variation       1279
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228464933"
     variation       1281
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314052452"
     variation       1291
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201768168"
     variation       1294..1369
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaattctatgactggaaagttttgggcagagttggacatgtgcactta
                     gcttccagaagacagaatccttttaaaa"
                     /replace="aaattctatgactggaaagttttgggcagagttggacatgtgcactta
                     gcttccagaagacagaatccttttaaaaaattctatgactggaaagttttgggcagag
                     ttggacatgtgcacttagcttccagaagacagaatccttttaaaa"
                     /db_xref="dbSNP:1568041420"
     variation       1297
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324082071"
     variation       1310
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049693398"
     variation       1318
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931401399"
     variation       1325
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053547236"
     variation       1332..1335
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1231457665"
     variation       1332
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200759561"
     variation       1333
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:943323174"
     variation       1336
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469677996"
     variation       1337
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910456486"
     variation       1350
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305215414"
     variation       1380
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415834276"
     variation       1386
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898551937"
     variation       1389
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163879478"
     variation       1394
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568041414"
     variation       1395
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297303404"
     variation       1407
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424088839"
     variation       1412
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985888308"
     variation       1413
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571731694"
     variation       1415
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141593913"
     variation       1416
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577775098"
     variation       1423
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314782199"
     variation       1426
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571414482"
     variation       1435
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450838450"
     variation       1440
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448081349"
     variation       1442
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381978746"
     variation       1445
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357857280"
     variation       1453
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293006718"
     variation       1455
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763379470"
     variation       1462
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768942247"
     variation       1471
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220924818"
     variation       1475
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271114121"
     variation       1481
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939868982"
     variation       1494
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:199758080"
     variation       1495..1496
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:11334455"
     variation       1506
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992077935"
     variation       1508
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:961538859"
     variation       1513
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017149955"
     variation       1514
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352820051"
     variation       1515
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484611862"
     variation       1523
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1187152930"
     variation       1530
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551558951"
     variation       1531
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478677058"
     variation       1538
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73958836"
     variation       1541
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1418319836"
     variation       1544
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979051647"
     variation       1546
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469552707"
     variation       1550
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:967797545"
     variation       1554
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384440601"
     variation       1556
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181535181"
     variation       1557
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1413701636"
     variation       1559
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425263266"
     variation       1560
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312803827"
     variation       1565
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341726172"
     variation       1569
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256813973"
     variation       1572
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433300337"
     variation       1577
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772735882"
     variation       1579
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338939372"
     variation       1580
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764682208"
     variation       1584
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282491112"
     variation       1592
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868109882"
     variation       1597
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041353"
     variation       1605
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528510196"
     variation       1611
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:906165191"
     variation       1618
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263773500"
     variation       1621
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358303617"
     variation       1623
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956213567"
     variation       1630
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020172490"
     variation       1647
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566416809"
     variation       1653..1657
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="actca"
                     /db_xref="dbSNP:1478110691"
     variation       1659
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548218101"
     variation       1670
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009358228"
     variation       1674
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392956324"
     variation       1678
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893548515"
     variation       1689
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1158778804"
     variation       1696
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:185165660"
     variation       1697
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562510833"
     variation       1699
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1893445"
     variation       1705
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326223423"
     variation       1716
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776308571"
     variation       1720
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437703097"
     variation       1721
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181163494"
     variation       1727
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1305893023"
     variation       1728
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051656183"
     variation       1733
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369101932"
     variation       1737
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233627454"
     variation       1745
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189520737"
     variation       1748
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203315260"
     variation       1752
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:933990549"
     variation       1758
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768354231"
     variation       1764
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148296454"
     variation       1765
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746838511"
     variation       1773
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1250732506"
     variation       1781
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535811836"
     variation       1789
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056674576"
     variation       1794
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940117697"
     variation       1799
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471409543"
     variation       1801
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909952131"
     variation       1804
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365192128"
     variation       1809
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185005464"
     variation       1812
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384956452"
     variation       1814
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406286894"
     variation       1818
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328400924"
     variation       1830
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392491788"
     variation       1835
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440481320"
     variation       1839
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984309373"
     variation       1847
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161858546"
     variation       1851
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309980368"
     variation       1852
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1337620674"
     variation       1857
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549310277"
     variation       1861
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926490825"
     variation       1863
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043445666"
     variation       1864
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775298629"
     variation       1865
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982346564"
     variation       1870..1874
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1467701731"
     variation       1870
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771909244"
     variation       1871
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9949903"
     variation       1879
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143260884"
     variation       1880
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009174264"
     variation       1881
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987894693"
     variation       1889
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180519146"
     variation       1904
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363703915"
     variation       1907
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966163578"
     variation       1911
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:562976462"
     variation       1917
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266362418"
     variation       1943
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224230727"
     variation       1949
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332276421"
     variation       1957
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032028035"
     variation       1958
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192902014"
     variation       1962
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888912090"
     variation       1970
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235067345"
     variation       1977
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1052117641"
     variation       1978
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954329658"
     variation       1981
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333871807"
     variation       1983
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315672122"
     variation       1984
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219082291"
     variation       1989
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028531247"
     variation       1993
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337094069"
     variation       1994
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194688024"
     variation       1999
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997479964"
     variation       2002
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486245817"
     variation       2012
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1229122097"
     variation       2016
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344907193"
     variation       2026
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897725485"
     variation       2027
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256087669"
     variation       2028
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388739058"
     variation       2035..2036
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1015984260"
     variation       2051
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:190266199"
     variation       2065
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171625089"
     variation       2066
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374956824"
     variation       2078
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555396114"
     variation       2082
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568041240"
     variation       2086
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184723102"
     variation       2089
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288088260"
     variation       2093
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004316397"
     variation       2105
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939982022"
     variation       2106
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414137822"
     variation       2108
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369605131"
     variation       2109
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1048475547"
     variation       2113
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756301716"
     variation       2116
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056305684"
     variation       2121
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226242256"
     variation       2124
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002028089"
     variation       2130
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:938163476"
     variation       2135
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756140608"
     variation       2137
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208184167"
     variation       2138
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278791363"
     variation       2139
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485645556"
     variation       2140
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200633271"
     variation       2142
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187435185"
     variation       2148
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:926851091"
     variation       2149
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426904302"
     variation       2161
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:982681042"
     variation       2174
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946394176"
     variation       2185
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308388724"
     variation       2187
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204918038"
     variation       2188
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171904685"
     variation       2193
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463792342"
     variation       2200
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420262360"
     variation       2202
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290342457"
     variation       2203
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359619607"
     variation       2220
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534679556"
     variation       2226
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270598736"
     variation       2229
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142342394"
     variation       2233
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192580252"
     variation       2237
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1298167160"
     variation       2245
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052491541"
     variation       2247
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987785192"
     variation       2248
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529907187"
     variation       2252
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032057580"
     variation       2260
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987027897"
     variation       2265
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954194977"
     variation       2270
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204958758"
     variation       2271
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1007222984"
     variation       2272
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235441443"
     variation       2279
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953244391"
     variation       2284
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041156"
     variation       2289
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455763916"
     variation       2294
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1030197765"
     variation       2301
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394560609"
     variation       2305..2310
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:558334880"
     variation       2306
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419540125"
     variation       2311
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343427718"
     variation       2314
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380337955"
     variation       2317
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452742405"
     variation       2319
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:974311410"
     variation       2321
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997742016"
     variation       2332
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897762614"
     variation       2338
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036661765"
     variation       2361
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321188911"
     variation       2363..2368
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1324571387"
     variation       2378
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041133"
     variation       2379
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376978709"
     variation       2380
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569137839"
     variation       2381
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309749556"
     variation       2385
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962907267"
     variation       2387
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781325359"
     variation       2394
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568041121"
     variation       2412
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041118"
     variation       2417
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535454543"
     variation       2422
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015595471"
     variation       2425
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469227979"
     variation       2432
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755167912"
     variation       2443
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004226020"
     variation       2445
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550498436"
     variation       2448
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048424116"
     variation       2451
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938111264"
     variation       2452
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905013591"
     variation       2454
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043550033"
     variation       2459
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186656934"
     variation       2460
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747541538"
     variation       2461..2479
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaacaaacaaacaaa"
                     /replace="aaacaaacaaacaaacaaa"
                     /replace="aaacaaacaaacaaacaaacaaa"
                     /db_xref="dbSNP:758782312"
     variation       2462
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1010830954"
     variation       2463
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419781436"
     variation       2467
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372175882"
     variation       2472
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190513348"
     variation       2473
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1354794188"
     variation       2476
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892344608"
     variation       2477..2480
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace=""
                     /replace="aaag"
                     /db_xref="dbSNP:1568041088"
     variation       2477
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295968570"
     variation       2478..2485
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aagt"
                     /replace="aagtaagt"
                     /db_xref="dbSNP:890237023"
     variation       2482
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:926687893"
     variation       2485
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337387343"
     variation       2486
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1272742462"
     variation       2490
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564957882"
     variation       2491
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206672544"
     variation       2496
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277046223"
     variation       2503
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540357202"
     variation       2518
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:914172105"
     variation       2521
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182234364"
     variation       2523
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948650"
     variation       2525
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542615586"
     variation       2539..2542
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1367184308"
     variation       2546
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298038644"
     variation       2547
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:924987477"
     variation       2552
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568041063"
     variation       2553
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372145638"
     variation       2557
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766722670"
     variation       2558
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758924603"
     variation       2559
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167620003"
     variation       2564
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35247708"
     variation       2565
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336045576"
     variation       2568
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314013843"
     variation       2574
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975956881"
     variation       2575..2576
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1414563779"
     variation       2575
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960971746"
     variation       2577
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1362844670"
     variation       2583..2592
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aaaat"
                     /replace="aaaataaaat"
                     /db_xref="dbSNP:1165831619"
     variation       2583
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216568314"
     variation       2585..2589
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:538649655"
     variation       2592
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1395114485"
     variation       2594
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431249990"
     variation       2600
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980865113"
     variation       2602
                     /gene="LINC-ROR"
                     /gene_synonym="lincRNA-RoR; lincRNA-ST8SIA3; ROR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568041030"
ORIGIN      
ggtgaaataaacagccatgttgctcacacaaagcctgtttggtggtctcttcacacggacgctcatgaaatttggtgatgtgactcggatagggggacctcccttgggagatcagtaccctgtcctcctgctctttgctccgtgagaaagatccacctacaacctcaggtccttagaccaaccagcccaagaaacatctcaccaatttcaaatccagaccccactggaaatcggactgtccaactcacctgacagccactcccacagccgctggaactctggcccaaggctctctgactccttcccagatcttcttggcttagcggctgaagactgacgctgcccgatcgcctcggaagccccctagaccatcacggacgccgagcttcgggtaactctcacagtggaagaaacacaactacagatttctacctggtgcatggccatcgctcatgaagactacaacttccagcttcctttgaagaaaaagaggacttgatggcattgtcgctaagtaagaaataatgtgtgtgacttcagggttgcccccttaaagggaggggacattttccatcctgctgttcagagtatggatgtgatgagagacatcttggatgatgcagaggaggtgaacaccccaggacaatgaaaccacaggagagaaagagcctgcgctggcccatctagcacagccactggacacagggaccacctgcctctgcactcttatggaaggaggaaatctaactttcccagtttaaggcactgttactttgggctcctgttacataactgtggcagaatgaaggttcaacatggaaactggcaatgttgaagaaacataaagttcattgcttgaatatctgaagttgtggactcaatctcatacctgctccacttatgagttatagttcttccaggtctcaggaatgggatcagcaggtctcagggttgtactctcctggatctctcaccagccacctcaaaccagctgccatagcctgtccacttccactccaatcttctcttccttcatcacctcccttgcacaccctgataacctcgaaagagaactcttcccaaggctctgttccaaacacatcgccactctgcttagaaccttcaatgactcctcatggcctaggaggtttctctcccatctggatccagctgacgttcccagcaccttctcctgactcctgtcttttcttgaaccagttctgcccaacaaggaggaaagggctgacagagtgaaagtcccagggcatgtgggaatgtgactcttttcactttaaattctatgactggaaagttttgggcagagttggacatgtgcacttagcttccagaagacagaatccttttaaaagagtcagagaaaacactggcttcctgccatgacatgagatacagacaggagagttgggaagctttttaaagatggcactatgactacaatcacagaaactctccatgaggaagtaaaagaaagcacctgcaacactccagctatgcagaccactctgtaatgggctcagatctggacaggtgtgtggaaaggtgggtcaacaggtcaggcgtcacagacttggaacattcatggtggaaaagaaaaagccccaaagaagagacttcaggataaatgagaaaatactcaagacagcaaaagtctcttttagaaatgttggagaaagaacacttaatgtcaggagttactgttgattgatggccttactgtgtagcaggtgagaaacccattgttcagttccctaaagtcaccctattctcccaatcatcctatggagggggaaccatgatggttatccccatcttataaataaagcaacagaggcttagaaggacgaactctttttctcaaggttacccagatcattttgcagaagtccctagatttgaatcatgctcttgctttgaggttaaagacacaggggaagtcgaactccttatctcctatatcctgaatagggaaaaccaaacattgtcaagaggagaggaagcctgagagttggcatgaatcagagtgctgggcagtctggagtcttccccactgagttgatgatggaacagtagagtggggcctgagccccgttagggcatgagctgctgaatgattcatgtgaacaccatgcacatgggagtgaggttttgagcagtgtgccacaggagcctaccctcaggccccaccataaaatgtagggccagtcctacattttatcaatgacttgcgtgaacacagaaaatgtggatacaaccaaaaggtaacaatccaattaaaaaatggacaaaaaacttgaataaacatttctcaaaagaagatatacaaatgatcaaaaagcatatgaaaaaatgctcaacatcgctaattgtaagagaaatgcaaatcaaaactataatgagataccaccttatattgattaggaagactgctataaaaatagtaaacaaacaaacaaacaaagtaagtcttggggaggatgcagagaaattaaaatttttgtgcactgttagtgggaatgtaaaatggtgcagctgttacgggaaacggtatgacagttcctcaaaaaataaaatgtagaaacagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]