GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:34:51, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NR_047518               2337 bp    RNA     linear   PRI 04-JUL-2020
DEFINITION  Homo sapiens HOX transcript antisense RNA (HOTAIR), transcript
            variant 3, long non-coding RNA.
ACCESSION   NR_047518
VERSION     NR_047518.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2337)
  AUTHORS   Zhao YH, Liu YL, Fei KL and Li P.
  TITLE     Long non-coding RNA HOTAIR modulates the progression of
            preeclampsia through inhibiting miR-106 in an EZH2-dependent manner
  JOURNAL   Life Sci. 253, 117668 (2020)
   PUBMED   32320706
  REMARK    GeneRIF: Long non-coding RNA HOTAIR modulates the progression of
            preeclampsia through inhibiting miR-106 in an EZH2-dependent manner
REFERENCE   2  (bases 1 to 2337)
  AUTHORS   Spokoini-Stern R, Stamov D, Jessel H, Aharoni L, Haschke H, Giron
            J, Unger R, Segal E, Abu-Horowitz A and Bachelet I.
  TITLE     Visualizing the structure and motion of the long noncoding RNA
            HOTAIR
  JOURNAL   RNA 26 (5), 629-636 (2020)
   PUBMED   32115425
  REMARK    GeneRIF: Our report provides a biologically plausible description
            of the anatomy and intrinsic properties of HOTAIR, and presents a
            framework for studying the structural biology of lncRNAs.
REFERENCE   3  (bases 1 to 2337)
  AUTHORS   Wasson CW, Abignano G, Hermes H, Malaab M, Ross RL, Jimenez SA,
            Chang HY, Feghali-Bostwick CA and Del Galdo F.
  TITLE     Long non-coding RNA HOTAIR drives EZH2-dependent myofibroblast
            activation in systemic sclerosis through miRNA 34a-dependent
            activation of NOTCH
  JOURNAL   Ann. Rheum. Dis. 79 (4), 507-517 (2020)
   PUBMED   32041748
  REMARK    GeneRIF: Data indicate that the EZH2-dependent epigenetic phenotype
            of myofibroblasts in systemic sclerosis is driven by HOTAIR and is
            linked to miRNA-34a repression-dependent activation of NOTCH
            signalling.
REFERENCE   4  (bases 1 to 2337)
  AUTHORS   Tao D, Zhang Z, Liu X, Zhang Z, Fu Y, Zhang P, Yuan H, Liu L, Cheng
            J and Jiang H.
  TITLE     LncRNA HOTAIR promotes the invasion and metastasis of oral squamous
            cell carcinoma through metastasis-associated gene 2
  JOURNAL   Mol. Carcinog. 59 (4), 353-364 (2020)
   PUBMED   31995261
  REMARK    GeneRIF: The HOX antisense intergenic RNA
            (HOTAIR)-miR-326-metastasis-associated gene 2 (MTA2) axis may
            contribute to a better understanding of oral squamous cell
            carcinoma (OSCC) pathogenesis and be a potential therapeutic target
            for OSCC.
REFERENCE   5  (bases 1 to 2337)
  AUTHORS   Volkohon AD, Kolnoguz AV, Chumachenko YD, Harbuzova VY and
            Tsyndrenko NL.
  TITLE     Association analysis between HOTAIR RS1899663 single nucleotide
            polymorphism and clear cell renal cell carcinoma development in
            Ukrainian population
  JOURNAL   Wiad. Lek. 73 (1), 12-16 (2020)
   PUBMED   32124799
  REMARK    GeneRIF: no association was found between HOTAIR
            rs1899663-polymorphic variant and clear cell renal cell carcinoma
            development in Ukrainian population.
REFERENCE   6  (bases 1 to 2337)
  AUTHORS   Tsai MC, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, Shi Y,
            Segal E and Chang HY.
  TITLE     Long noncoding RNA as modular scaffold of histone modification
            complexes
  JOURNAL   Science 329 (5992), 689-693 (2010)
   PUBMED   20616235
  REMARK    GeneRIF: findings show that the lincRNA HOTAIR serves as a scaffold
            for at least two distinct histone modification complexes; A 5'
            domain of HOTAIR binds polycomb repressive complex 2 (PRC2),
            whereas a 3' domain of HOTAIR binds the LSD1/CoREST/REST complex
REFERENCE   7  (bases 1 to 2337)
  AUTHORS   Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC,
            Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West
            RB, van de Vijver MJ, Sukumar S and Chang HY.
  TITLE     Long non-coding RNA HOTAIR reprograms chromatin state to promote
            cancer metastasis
  JOURNAL   Nature 464 (7291), 1071-1076 (2010)
   PUBMED   20393566
  REMARK    GeneRIF: The lincRNA termed HOTAIR is increased in expression in
            primary breast tumours and metastases, and HOTAIR expression level
            in primary tumours is a powerful predictor of eventual metastasis
            and death.
REFERENCE   8  (bases 1 to 2337)
  AUTHORS   Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D,
            Thomas K, Presser A, Bernstein BE, van Oudenaarden A, Regev A,
            Lander ES and Rinn JL.
  TITLE     Many human large intergenic noncoding RNAs associate with
            chromatin-modifying complexes and affect gene expression
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 106 (28), 11667-11672 (2009)
   PUBMED   19571010
REFERENCE   9  (bases 1 to 2337)
  AUTHORS   Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA,
            Goodnough LH, Helms JA, Farnham PJ, Segal E and Chang HY.
  TITLE     Functional demarcation of active and silent chromatin domains in
            human HOX loci by noncoding RNAs
  JOURNAL   Cell 129 (7), 1311-1323 (2007)
   PUBMED   17604720
REFERENCE   10 (bases 1 to 2337)
  AUTHORS   Woo CJ and Kingston RE.
  TITLE     HOTAIR lifts noncoding RNAs to new levels
  JOURNAL   Cell 129 (7), 1257-1259 (2007)
   PUBMED   17604716
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA907429.1 and AC012531.11.
            
            Summary: This gene is located within the Homeobox C (HOXC) gene
            cluster on chromosome 12 and is co-expressed with the HOXC genes.
            It functions through an RNA product, which binds lysine specific
            demethylase 1 (LSD1) and Polycomb repressive complex 2 (PRC2), and
            serves as a scaffold to assemble these regulators at the HOXD gene
            cluster, thereby promoting epigenetic repression of HOXD. This gene
            is highly expressed in multiple tumors. Alternatively spliced
            transcript variants have been identified. [provided by RefSeq, Feb
            2019].
            
            Transcript Variant: This variant (3) has an alternate 5' sequence
            and lacks an internal exon in the 5' region, compared to variant 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA907429.1, DA907474.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148093
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-113               DA907429.1         1-113
            114-560             DA907429.1         115-561
            561-2337            AC012531.11        99912-101688        c
FEATURES             Location/Qualifiers
     source          1..2337
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.13"
     gene            1..2337
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /note="HOX transcript antisense RNA"
                     /db_xref="GeneID:100124700"
                     /db_xref="HGNC:HGNC:33510"
                     /db_xref="MIM:611400"
     ncRNA           1..2337
                     /ncRNA_class="lncRNA"
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /product="HOX transcript antisense RNA, transcript variant
                     3"
                     /db_xref="GeneID:100124700"
                     /db_xref="HGNC:HGNC:33510"
                     /db_xref="MIM:611400"
     exon            1..298
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937062129"
     variation       13
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430223475"
     variation       15
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169056744"
     variation       17
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:910069538"
     variation       19
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984287473"
     variation       24
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891940080"
     variation       28
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172043055"
     variation       32
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377435529"
     variation       35
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033188712"
     variation       37
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930260662"
     variation       43
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918854076"
     variation       45
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360576308"
     variation       52
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384385539"
     variation       56
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298860634"
     variation       58
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533687784"
     variation       61
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976963329"
     variation       65
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388707394"
     variation       70
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391981617"
     variation       88
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325635354"
     variation       93..110
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="caaaaacaaaaa"
                     /replace="caaaaacaaaaacaaaaa"
                     /db_xref="dbSNP:1312352718"
     variation       94
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906109875"
     variation       95
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771659574"
     variation       99
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460350550"
     variation       101
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426327465"
     variation       104
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775398987"
     variation       105
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1477835519"
     variation       106..114
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /replace="aaaaaaaaaa"
                     /db_xref="dbSNP:199734232"
     variation       111
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:895842241"
     variation       112..113
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:148025014"
     variation       112
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047782126"
     variation       113..114
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:71227279"
     variation       113
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74613444"
     variation       114
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:1555179650"
     variation       137
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452974476"
     variation       138
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195205553"
     variation       141
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958088696"
     variation       142
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566541805"
     variation       144
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929408114"
     variation       149
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1158531660"
     variation       154
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592194160"
     variation       168
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343482934"
     variation       173
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918382727"
     variation       176
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973937487"
     variation       177
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212780552"
     variation       182
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000022974"
     variation       183
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748540504"
     variation       186
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902984322"
     variation       187
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439174192"
     variation       190
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306064006"
     variation       195
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367949505"
     variation       202
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222818557"
     variation       203
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548034593"
     variation       207
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318230854"
     variation       211
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567709233"
     variation       214
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014104080"
     variation       216
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467076531"
     variation       217
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298857007"
     variation       219
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195345858"
     variation       220
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895500914"
     variation       227
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055376129"
     variation       232
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219139761"
     variation       234
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779286783"
     variation       244
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532719220"
     variation       246
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888200177"
     variation       247
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768878421"
     variation       251
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955006633"
     variation       255
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325992702"
     variation       256
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235771740"
     variation       265
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441885167"
     variation       266
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277417318"
     variation       267
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73313155"
     variation       271
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292129413"
     variation       272
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332641018"
     variation       278
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930162795"
     variation       279
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988526299"
     variation       285
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437044161"
     variation       292
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202095733"
     variation       293
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041331363"
     variation       294
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439108082"
     variation       298
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911248229"
     exon            299..400
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       301
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236730164"
     variation       308
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757175770"
     variation       314
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555670580"
     variation       319
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199493539"
     variation       328
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:916649958"
     variation       343
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251078152"
     variation       349..364
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ggggagtggggagtgg"
                     /replace="ggggagtggggagtggggagtgg"
                     /db_xref="dbSNP:1364195419"
     variation       352
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592193256"
     variation       359
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471555649"
     variation       362
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592193253"
     variation       364
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:990887196"
     variation       368
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987576454"
     variation       374
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337982628"
     variation       376
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954774061"
     variation       384
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534252584"
     variation       389
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996698437"
     variation       391
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:964177234"
     variation       392
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395117843"
     variation       393
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022229524"
     variation       399
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1166375692"
     exon            401..520
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       406
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044397783"
     variation       408
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469560725"
     variation       411..413
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:954658987"
     variation       420
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453760897"
     variation       423
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319537838"
     variation       432
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190087427"
     variation       435
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010887847"
     variation       450..460
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="gaccagaaatg"
                     /db_xref="dbSNP:1257025536"
     variation       459
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383452611"
     variation       460
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975206638"
     variation       464
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221647373"
     variation       471
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208959780"
     variation       475
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551007666"
     variation       478
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867620883"
     variation       494
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241814553"
     variation       496
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055104380"
     variation       502..503
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1010845288"
     variation       502
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188410313"
     variation       503
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939443294"
     variation       511
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480111840"
     variation       516
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956621629"
     variation       520
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529367168"
     exon            521..2337
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       522
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333033817"
     variation       523
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954591197"
     variation       524
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164939890"
     variation       526
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021265875"
     variation       527
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894551180"
     variation       530
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341702164"
     variation       533
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1009500773"
     variation       544
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1250674043"
     variation       545
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192529"
     variation       549
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183607878"
     variation       555
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893440759"
     variation       559
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017398932"
     variation       574..583
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="agagagag"
                     /replace="agagagagag"
                     /db_xref="dbSNP:1200046963"
     variation       580
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260288344"
     variation       581
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1053388018"
     variation       589
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536505412"
     variation       590
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192524"
     variation       591
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425573283"
     variation       593
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904946081"
     variation       594
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428952127"
     variation       595
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565711253"
     variation       597
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046162992"
     variation       602
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423534587"
     variation       608
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247168509"
     variation       609
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949567501"
     variation       610
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908729786"
     variation       619
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929197676"
     variation       623
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592192516"
     variation       625
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867710570"
     variation       628
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469709663"
     variation       631
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778772853"
     variation       632
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396099510"
     variation       633
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756827347"
     variation       635
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753712445"
     variation       643
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901530450"
     variation       647
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931583861"
     variation       651
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331693259"
     variation       652
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253717777"
     variation       663
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209261817"
     variation       668
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200062893"
     variation       671..673
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:869293596"
     variation       672
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:111434707"
     variation       672
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:763855108"
     variation       672
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17840857"
     variation       673..675
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:201299570"
     variation       676
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975401876"
     variation       680
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547139015"
     variation       681
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:942706628"
     variation       689
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191759592"
     variation       693
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912632199"
     variation       706
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1484316451"
     variation       714
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341984552"
     variation       720
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:990281857"
     variation       727..732
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1565711221"
     variation       733..736
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1487608632"
     variation       733..734
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1372303428"
     variation       733
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187384923"
     variation       742
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196424288"
     variation       744
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592192481"
     variation       745
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424795327"
     variation       746
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432911935"
     variation       748
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565711206"
     variation       751..752
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1323683620"
     variation       752
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173596255"
     variation       754
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954670712"
     variation       755
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1466145508"
     variation       758
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358025452"
     variation       767
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020795065"
     variation       770
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592192465"
     variation       779
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988424649"
     variation       781
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344704354"
     variation       793
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217260946"
     variation       794
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299517387"
     variation       801
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314143535"
     variation       810
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234177164"
     variation       813
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557438483"
     variation       817
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351519751"
     variation       819
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756103880"
     variation       820
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763629259"
     variation       821
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971616067"
     variation       825
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488399670"
     variation       836
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189831317"
     variation       845
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192446"
     variation       848
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192445"
     variation       849
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169346978"
     variation       852
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565711170"
     variation       853
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429994691"
     variation       854
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024758974"
     variation       856
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433417836"
     variation       857
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032257118"
     variation       859
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762563705"
     variation       860
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377973258"
     variation       861
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001814400"
     variation       865
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535935865"
     variation       866
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017039103"
     variation       867
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1349222122"
     variation       868
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192426"
     variation       869..871
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:951889973"
     variation       870
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005612419"
     variation       871..878
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="cggctcgg"
                     /replace="cggctcggctcgg"
                     /db_xref="dbSNP:1219927663"
     variation       872
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026136414"
     variation       873
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387592952"
     variation       876
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545965699"
     variation       877..878
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /replace="ctcc"
                     /db_xref="dbSNP:201948416"
     variation       877
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7958904"
     variation       878
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287439853"
     variation       879
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759916627"
     variation       883
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887233959"
     variation       888
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488984158"
     variation       892..898
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccacacc"
                     /replace="ccacaccacacc"
                     /db_xref="dbSNP:888749359"
     variation       893
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177678547"
     variation       894
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235944994"
     variation       896
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192395"
     variation       898
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252735419"
     variation       899
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441073401"
     variation       900
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054161080"
     variation       901
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196611429"
     variation       904
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935734380"
     variation       910
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350272625"
     variation       923
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924819030"
     variation       928
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047222833"
     variation       934
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1838169"
     variation       938..939
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:531203390"
     variation       942
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310090131"
     variation       951
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378482880"
     variation       952
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542209426"
     variation       956
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227130335"
     variation       959
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574785476"
     variation       966
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:553393371"
     variation       971
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315411296"
     variation       973
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60674771"
     variation       981..985
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:958748523"
     variation       984
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040003410"
     variation       985
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:942652708"
     variation       990
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255824088"
     variation       993
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912579640"
     variation       999
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909862812"
     variation       1002
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330235164"
     variation       1005
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471493830"
     variation       1006
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987256220"
     variation       1007
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577388608"
     variation       1008
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984230776"
     variation       1012
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369502915"
     variation       1021
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74348153"
     variation       1022
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951440399"
     variation       1023
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946156788"
     variation       1024..1026
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1026187033"
     variation       1025..1035
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccgctcagccg"
                     /replace="ccgctcagccgctcagccg"
                     /db_xref="dbSNP:1191516592"
     variation       1027
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913345903"
     variation       1031
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192336"
     variation       1033
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993339142"
     variation       1034
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868156619"
     variation       1035
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1018874795"
     variation       1035
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141850773"
     variation       1037
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1007876110"
     variation       1038
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276702650"
     variation       1042
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171981971"
     variation       1045
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957896168"
     variation       1047
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032204756"
     variation       1049..1054
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1565711061"
     variation       1055
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192320"
     variation       1057
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:536808709"
     variation       1066
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277448355"
     variation       1067..1075
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="taatt"
                     /replace="taattaatt"
                     /db_xref="dbSNP:1237498650"
     variation       1068
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182560442"
     variation       1070
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:569944537"
     variation       1075
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773201616"
     variation       1081
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487925940"
     variation       1084
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1472406939"
     variation       1089
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1425538782"
     variation       1097
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249943809"
     variation       1102
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181740093"
     variation       1103
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486237833"
     variation       1104
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592192294"
     variation       1106
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192291"
     variation       1109
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1278358509"
     variation       1110
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199248163"
     variation       1111
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192285"
     variation       1112
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412896617"
     variation       1118
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536546782"
     variation       1119
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353395309"
     variation       1120
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192278"
     variation       1123
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377235669"
     variation       1130
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024643404"
     variation       1138
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399963842"
     variation       1139
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296832719"
     variation       1149
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280806267"
     variation       1150
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013707331"
     variation       1151
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192272"
     variation       1161
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373913062"
     variation       1169
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950262255"
     variation       1170
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280463879"
     variation       1174..1178
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1352275715"
     variation       1179
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546974474"
     variation       1185
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214424850"
     variation       1195
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349299764"
     variation       1198
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:917378331"
     variation       1204
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189376086"
     variation       1208
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995655370"
     variation       1214
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564610577"
     variation       1216
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244706446"
     variation       1217
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416226724"
     variation       1218
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056081367"
     variation       1219..1226
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aag"
                     /replace="aaggaaag"
                     /db_xref="dbSNP:1592192245"
     variation       1227
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359592266"
     variation       1228
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395791276"
     variation       1231
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17720428"
     variation       1232
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157422478"
     variation       1234
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039949207"
     variation       1240
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362996876"
     variation       1241
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401705657"
     variation       1247
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592192226"
     variation       1251
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323320284"
     variation       1252
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412712583"
     variation       1255..1260
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ca"
                     /replace="caaaca"
                     /db_xref="dbSNP:1438203339"
     variation       1261
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565710983"
     variation       1262
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:530961052"
     variation       1267
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375572746"
     variation       1275
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237320952"
     variation       1284
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1288149388"
     variation       1288
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192215"
     variation       1289
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351326811"
     variation       1290
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209099344"
     variation       1298
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287504215"
     variation       1302
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:909925773"
     variation       1303
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12312094"
     variation       1305
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439233122"
     variation       1315
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176838793"
     variation       1316
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051101391"
     variation       1319
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:542198492"
     variation       1322
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409834772"
     variation       1323
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946073278"
     variation       1325
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:552406812"
     variation       1325
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918678641"
     variation       1330
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530402572"
     variation       1334
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1407403780"
     variation       1343
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377691358"
     variation       1344
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054973538"
     variation       1348..1350
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:36075637"
     variation       1354
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1326250742"
     variation       1355
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184960732"
     variation       1359
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936486557"
     variation       1361
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192178"
     variation       1362
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449263047"
     variation       1366
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285618780"
     variation       1370
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986104662"
     variation       1379
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925132966"
     variation       1398
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192169"
     variation       1400
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244001226"
     variation       1401
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953406981"
     variation       1403
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577428774"
     variation       1409
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201059190"
     variation       1413
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592192161"
     variation       1414
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980614936"
     variation       1415
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192156"
     variation       1417
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:969273430"
     variation       1419
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274099645"
     variation       1422
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327934059"
     variation       1423
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457491972"
     variation       1424
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032854056"
     variation       1426
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773650430"
     variation       1427
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234766735"
     variation       1431
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769579512"
     variation       1438
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020006991"
     variation       1440
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367232604"
     variation       1444
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474011970"
     variation       1445
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379385708"
     variation       1446
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423275180"
     variation       1451
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192133"
     variation       1459
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014410307"
     variation       1460
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143161957"
     variation       1473
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1025368737"
     variation       1476
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995267561"
     variation       1487
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543608618"
     variation       1490
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780157367"
     variation       1492
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770014270"
     variation       1503
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018457824"
     variation       1506
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342176687"
     variation       1510
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233757879"
     variation       1514
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192112"
     variation       1518
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1456637137"
     variation       1523
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315784541"
     variation       1524
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937642111"
     variation       1529
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386552179"
     variation       1532
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481039808"
     variation       1537
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199930403"
     variation       1539
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007104829"
     variation       1542
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1048639846"
     variation       1544
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192099"
     variation       1547
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189217352"
     variation       1553
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262948942"
     variation       1558
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477032746"
     variation       1560
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172421079"
     variation       1581
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929980330"
     variation       1582
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891370538"
     variation       1585
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161647261"
     variation       1586
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170306476"
     variation       1589
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192090"
     variation       1590
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745603728"
     variation       1592
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976884915"
     variation       1593
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192082"
     variation       1594
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297485089"
     variation       1599
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338200010"
     variation       1605
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192075"
     variation       1606
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1401614939"
     variation       1607
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:576206070"
     variation       1611
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298075397"
     variation       1620
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476619679"
     variation       1625
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010222121"
     variation       1626
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:534309238"
     variation       1627
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308315511"
     variation       1633
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565710841"
     variation       1638
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891812143"
     variation       1644
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554742485"
     variation       1646
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139288906"
     variation       1657
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212286165"
     variation       1658
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944115356"
     variation       1676
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463880452"
     variation       1682
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487549130"
     variation       1687
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911761187"
     variation       1691
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986377071"
     variation       1692
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245693827"
     variation       1693
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192057"
     variation       1698
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1223080018"
     variation       1708
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262792108"
     variation       1709
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432236427"
     variation       1719
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:936097552"
     variation       1721
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192050"
     variation       1722
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196252163"
     variation       1724
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396416026"
     variation       1726
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953175546"
     variation       1727
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927420453"
     variation       1730
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565619013"
     variation       1735
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145860004"
     variation       1740
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142098625"
     variation       1745
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992503794"
     variation       1746
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366597313"
     variation       1753
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757226391"
     variation       1754
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537392970"
     variation       1757
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373336565"
     variation       1759
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895547985"
     variation       1769
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918254795"
     variation       1770
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1352163599"
     variation       1772
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218473289"
     variation       1776
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261709666"
     variation       1780
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1565710786"
     variation       1780
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:571012711"
     variation       1786
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207744928"
     variation       1787
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254493189"
     variation       1788
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328042506"
     variation       1792
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1177482763"
     variation       1792
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751492661"
     variation       1795
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437330587"
     variation       1807
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420841549"
     variation       1810
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:180939821"
     variation       1818
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349136360"
     variation       1820
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163014526"
     variation       1821
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456170251"
     variation       1823
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324215384"
     variation       1837
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396938683"
     variation       1841
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1048691635"
     variation       1845
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930191397"
     variation       1851
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018072426"
     variation       1853
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226029274"
     variation       1854
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168304186"
     variation       1855
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448240105"
     variation       1856
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219814039"
     variation       1859
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571976806"
     variation       1874
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1468645201"
     variation       1875
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197577538"
     variation       1876
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955755349"
     variation       1882
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481314907"
     variation       1883
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177749242"
     variation       1885..1886
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1412972039"
     variation       1887
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029893766"
     variation       1893
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041432837"
     variation       1894
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166841389"
     variation       1903
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418216768"
     variation       1906
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462191032"
     variation       1910
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330872135"
     variation       1915
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757922994"
     variation       1921
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444461420"
     variation       1925
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299307304"
     variation       1931
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379104546"
     variation       1934..1941
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1335850402"
     variation       1940..1941
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:33918810"
     variation       1941..1942
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="ac"
                     /replace="c"
                     /replace="ctcagcagatggagattaccattcccaatagaaaaaaaac"
                     /db_xref="dbSNP:3839967"
     variation       1941..1942
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:869193878"
     variation       1941..1942
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="at"
                     /replace="c"
                     /db_xref="dbSNP:1555179144"
     variation       1941
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200349340"
     variation       1944
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911298009"
     variation       1945
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218937922"
     variation       1949
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:985538057"
     variation       1964
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752299278"
     variation       1977
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:3839968"
     variation       1977
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:779678471"
     variation       1977
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199717584"
     variation       1980
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257989884"
     variation       1983
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477356826"
     variation       1984
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170321747"
     variation       1987
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417626890"
     variation       1989
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305599084"
     variation       1994
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171228761"
     variation       1995
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358607991"
     variation       2000
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219723304"
     variation       2005..2006
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1413499618"
     variation       2007
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367073806"
     variation       2008..2012
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1291788494"
     variation       2019
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444652767"
     variation       2026
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764888962"
     variation       2030
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315327246"
     variation       2037
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356547994"
     variation       2040
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2366152"
     variation       2043
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307621641"
     variation       2044..2057
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="attt"
                     /replace="atttcaatgtattt"
                     /db_xref="dbSNP:1377643870"
     variation       2050
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268108497"
     variation       2051
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341054097"
     variation       2053
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1044481243"
     variation       2055
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214722122"
     variation       2057
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428280012"
     variation       2060
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560050858"
     variation       2061
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212994142"
     variation       2063
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912930772"
     variation       2065..2086
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="acacagtatgtatataaacaca"
                     /replace="acacagtatgtatataaacacagtatgtatataaacaca"
                     /db_xref="dbSNP:574452187"
     variation       2065
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487874849"
     variation       2066
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177510527"
     variation       2069
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1191258662"
     variation       2070
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541444610"
     variation       2073
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476531777"
     variation       2075
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187283078"
     variation       2076
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532504818"
     variation       2080
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424612552"
     variation       2083
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754219999"
     variation       2086
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432908759"
     variation       2092
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376579311"
     variation       2095
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866572114"
     variation       2097
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929884448"
     variation       2099
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:565281087"
     variation       2106
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473385455"
     variation       2111
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918547728"
     variation       2123
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766816108"
     variation       2133
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273853479"
     variation       2135
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203970931"
     variation       2142
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973726957"
     variation       2148
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745409441"
     variation       2149
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235837226"
     variation       2154
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001264122"
     variation       2156
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592191842"
     variation       2157
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352909321"
     variation       2160
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761309417"
     variation       2162..2165
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1203270825"
     variation       2170
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773752738"
     variation       2172
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210730449"
     variation       2173
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985634864"
     variation       2175
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447344953"
     variation       2179
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543594797"
     variation       2190
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311472860"
     variation       2193
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246340667"
     variation       2194
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452721105"
     variation       2199
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030253094"
     variation       2207
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195592745"
     variation       2215
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1395696310"
     variation       2217
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439651541"
     variation       2223
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772107865"
     variation       2225
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157287769"
     variation       2234
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370220472"
     variation       2242
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989039856"
     variation       2252
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1391858425"
     variation       2253
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994453010"
     variation       2261
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375454291"
     variation       2265
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236852759"
     variation       2268
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281182840"
     variation       2270..2271
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="caagg"
                     /db_xref="dbSNP:1351214496"
     variation       2271
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553391907"
     variation       2273
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554496458"
     variation       2276
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761884512"
     variation       2284..2295
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tgtgtgtgtg"
                     /replace="tgtgtgtgtgtg"
                     /replace="tgtgtgtgtgtgtg"
                     /db_xref="dbSNP:1008663091"
     variation       2287
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041260767"
     variation       2290
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566536199"
     variation       2299
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215739843"
     variation       2303
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026705186"
     variation       2308..2316
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ataaa"
                     /replace="ataaataaa"
                     /db_xref="dbSNP:879481932"
     regulatory      2311..2316
                     /regulatory_class="polyA_signal_sequence"
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
     variation       2311..2315
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:879919356"
     variation       2313..2318
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="t"
                     /replace="taaagt"
                     /db_xref="dbSNP:936741607"
     variation       2313
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:534879867"
     variation       2313
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111294925"
     variation       2315..2318
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="aagt"
                     /db_xref="dbSNP:552357611"
     variation       2317..2318
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:879383432"
     variation       2323
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137995449"
     variation       2324
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377657236"
     variation       2327
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905889573"
     variation       2329
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546692438"
     variation       2336
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014761939"
     polyA_site      2337
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
ORIGIN      
ctaatcaatccaaaaggaaaaagaaaagagaggggtgggaaggcatggggtgaaaaacttcaggtgacacaaagcaaaaagattccagtcaccaaaaacaaaaacaaaaaaaaatcttttgcccccagcaagaatcatttgtttgggatctgttccagcctccaggccctgccttctgcctgcacattctgccctgatttccggaacctggaagcctaggcaggcagtggggaactctgactcgcctgtgctctggagcttgatccgaaagcttccacagtgaggactgctccgtggggtcctgctccgcttcgcagtggaatggaacggatttagaagcctgcagtaggggagtggggagtggagagagggagcccagagttacagacggcggcgagaggaggggcgtctttatttttttaaggccccaaagagtctgatgtttacaagaccagaaatgccacggccgcgtcctggcagagaaaaggctgaaatggaggaccggcgccttccttataagctcgttggggcctaagccagtaccgacctggtagaaaaagcaaccacgaagctagagagagagccagaggagggaagagagcgccagacgaaggtgaaagcgaaccacgcagagaaatgcaggcaagggagcaaggcggcagttcccggaacaaacgtggcagagggcaagacgggcactcacagacagaggtttatgtatttttattttttaaaatctgatttggtgttccatgaggaaaagggaaaatctagggaacgggagtacagagagaataatccgggtcctagctcgccacatgaacgcccagagaacgctggaaaaacctgagcgggtgccggggcagcacccggctcgggtcagccactgccccacaccgggcccaccaagccccgcccctcgcggccaccggggcttccttgctcttcttatcatctccatctttatgatgaggcttgttaacaagaccagagagctggccaagcacctctatctcagccgcgcccgctcagccgagcagcggtcggtggggggactgggaggcgctaattaattgattcctttggactgtaaaatatggcggcgtctacacggaacccatggactcataaacaatatatctgttgggcgtgagtgcactgtctctcaaataatttttccataggcaaatgtcagagggttctggatttttagttgctaaggaaagatccaaatgggaccaattttaggaggcccaaacagagtccgttcagtgtcagaaaatgcttccccaaaggggttgggagtgtgttttgttggaaaaaagcttgggttataggaaagcctttccctgctacttgtgtagacccagcccaatttaagaattacaaggaagcgaaggggttgtgtaggccggaagcctctctgtcccggctggatgcaggggacttgagctgctccggaatttgagaggaacatagaagcaaaggtccagcctttgcttcgtgctgattcctagacttaagattcaaaaacaaatttttaaaagtgaaaccagccctagcctttggaagctcttgaaggttcagcacccacccaggaatccacctgcctgttacacgcctctccaagacacagtggcaccgcttttctaactggcagcacagagcaactctataatatgcttatattaggtctagaagaatgcatcttgagacacatgggtaacctaattatataatgcttgttccatacaggagtgattatgcagtgggaccctgctgcaaacgggactttgcactctaaatatagaccccagcttgggacaaaagttgcagtagaaaaatagacataggagaacacttaaataagtgatgcatgtagacacagaaggggtatttaaaagacagaaataatagaagtacagaagaacagaaaaaaaatcagcagatggagattaccattcccaatgcctgaacttcctcctgctattaagattgctagagaattgtgtcttaaacagttcatgaacccagaagaatgcaatttcaatgtatttagtacacacacagtatgtatataaacacaactcacagaatatattttccatacattgggtaggtatgcactttgtgtatatataataatgtattttccatgcagttttaaaatgtagatatattaatatctggatgcattttctgtgcactggttttatatgccttatggagtatatactcacatgtagctaaatagactcaggactgcacattccttgtgtaggttgtgtgtgtgtggtggttttatgcataaataaagttttacatgtggtgaatata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]