GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:19:33, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NR_047517               2370 bp    RNA     linear   PRI 04-JUL-2020
DEFINITION  Homo sapiens HOX transcript antisense RNA (HOTAIR), transcript
            variant 1, long non-coding RNA.
ACCESSION   NR_047517
VERSION     NR_047517.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2370)
  AUTHORS   Zhao YH, Liu YL, Fei KL and Li P.
  TITLE     Long non-coding RNA HOTAIR modulates the progression of
            preeclampsia through inhibiting miR-106 in an EZH2-dependent manner
  JOURNAL   Life Sci. 253, 117668 (2020)
   PUBMED   32320706
  REMARK    GeneRIF: Long non-coding RNA HOTAIR modulates the progression of
            preeclampsia through inhibiting miR-106 in an EZH2-dependent manner
REFERENCE   2  (bases 1 to 2370)
  AUTHORS   Spokoini-Stern R, Stamov D, Jessel H, Aharoni L, Haschke H, Giron
            J, Unger R, Segal E, Abu-Horowitz A and Bachelet I.
  TITLE     Visualizing the structure and motion of the long noncoding RNA
            HOTAIR
  JOURNAL   RNA 26 (5), 629-636 (2020)
   PUBMED   32115425
  REMARK    GeneRIF: Our report provides a biologically plausible description
            of the anatomy and intrinsic properties of HOTAIR, and presents a
            framework for studying the structural biology of lncRNAs.
REFERENCE   3  (bases 1 to 2370)
  AUTHORS   Wasson CW, Abignano G, Hermes H, Malaab M, Ross RL, Jimenez SA,
            Chang HY, Feghali-Bostwick CA and Del Galdo F.
  TITLE     Long non-coding RNA HOTAIR drives EZH2-dependent myofibroblast
            activation in systemic sclerosis through miRNA 34a-dependent
            activation of NOTCH
  JOURNAL   Ann. Rheum. Dis. 79 (4), 507-517 (2020)
   PUBMED   32041748
  REMARK    GeneRIF: Data indicate that the EZH2-dependent epigenetic phenotype
            of myofibroblasts in systemic sclerosis is driven by HOTAIR and is
            linked to miRNA-34a repression-dependent activation of NOTCH
            signalling.
REFERENCE   4  (bases 1 to 2370)
  AUTHORS   Tao D, Zhang Z, Liu X, Zhang Z, Fu Y, Zhang P, Yuan H, Liu L, Cheng
            J and Jiang H.
  TITLE     LncRNA HOTAIR promotes the invasion and metastasis of oral squamous
            cell carcinoma through metastasis-associated gene 2
  JOURNAL   Mol. Carcinog. 59 (4), 353-364 (2020)
   PUBMED   31995261
  REMARK    GeneRIF: The HOX antisense intergenic RNA
            (HOTAIR)-miR-326-metastasis-associated gene 2 (MTA2) axis may
            contribute to a better understanding of oral squamous cell
            carcinoma (OSCC) pathogenesis and be a potential therapeutic target
            for OSCC.
REFERENCE   5  (bases 1 to 2370)
  AUTHORS   Volkohon AD, Kolnoguz AV, Chumachenko YD, Harbuzova VY and
            Tsyndrenko NL.
  TITLE     Association analysis between HOTAIR RS1899663 single nucleotide
            polymorphism and clear cell renal cell carcinoma development in
            Ukrainian population
  JOURNAL   Wiad. Lek. 73 (1), 12-16 (2020)
   PUBMED   32124799
  REMARK    GeneRIF: no association was found between HOTAIR
            rs1899663-polymorphic variant and clear cell renal cell carcinoma
            development in Ukrainian population.
REFERENCE   6  (bases 1 to 2370)
  AUTHORS   Tsai MC, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, Shi Y,
            Segal E and Chang HY.
  TITLE     Long noncoding RNA as modular scaffold of histone modification
            complexes
  JOURNAL   Science 329 (5992), 689-693 (2010)
   PUBMED   20616235
  REMARK    GeneRIF: findings show that the lincRNA HOTAIR serves as a scaffold
            for at least two distinct histone modification complexes; A 5'
            domain of HOTAIR binds polycomb repressive complex 2 (PRC2),
            whereas a 3' domain of HOTAIR binds the LSD1/CoREST/REST complex
REFERENCE   7  (bases 1 to 2370)
  AUTHORS   Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC,
            Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West
            RB, van de Vijver MJ, Sukumar S and Chang HY.
  TITLE     Long non-coding RNA HOTAIR reprograms chromatin state to promote
            cancer metastasis
  JOURNAL   Nature 464 (7291), 1071-1076 (2010)
   PUBMED   20393566
  REMARK    GeneRIF: The lincRNA termed HOTAIR is increased in expression in
            primary breast tumours and metastases, and HOTAIR expression level
            in primary tumours is a powerful predictor of eventual metastasis
            and death.
REFERENCE   8  (bases 1 to 2370)
  AUTHORS   Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D,
            Thomas K, Presser A, Bernstein BE, van Oudenaarden A, Regev A,
            Lander ES and Rinn JL.
  TITLE     Many human large intergenic noncoding RNAs associate with
            chromatin-modifying complexes and affect gene expression
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 106 (28), 11667-11672 (2009)
   PUBMED   19571010
REFERENCE   9  (bases 1 to 2370)
  AUTHORS   Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA,
            Goodnough LH, Helms JA, Farnham PJ, Segal E and Chang HY.
  TITLE     Functional demarcation of active and silent chromatin domains in
            human HOX loci by noncoding RNAs
  JOURNAL   Cell 129 (7), 1311-1323 (2007)
   PUBMED   17604720
REFERENCE   10 (bases 1 to 2370)
  AUTHORS   Woo CJ and Kingston RE.
  TITLE     HOTAIR lifts noncoding RNAs to new levels
  JOURNAL   Cell 129 (7), 1257-1259 (2007)
   PUBMED   17604716
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA905601.1, AC012531.11 and
            AA399272.1.
            
            Summary: This gene is located within the Homeobox C (HOXC) gene
            cluster on chromosome 12 and is co-expressed with the HOXC genes.
            It functions through an RNA product, which binds lysine specific
            demethylase 1 (LSD1) and Polycomb repressive complex 2 (PRC2), and
            serves as a scaffold to assemble these regulators at the HOXD gene
            cluster, thereby promoting epigenetic repression of HOXD. This gene
            is highly expressed in multiple tumors. Alternatively spliced
            transcript variants have been identified. [provided by RefSeq, Feb
            2019].
            
            Transcript Variant: This variant (1) consists of six exons.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA905601.1, DA906831.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2151119, SAMEA2161674
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-560               DA905601.1         1-560
            561-2223            AC012531.11        100057-101719       c
            2224-2370           AA399272.1         1-147               c
FEATURES             Location/Qualifiers
     source          1..2370
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.13"
     gene            1..2370
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /note="HOX transcript antisense RNA"
                     /db_xref="GeneID:100124700"
                     /db_xref="HGNC:HGNC:33510"
                     /db_xref="MIM:611400"
     ncRNA           1..2370
                     /ncRNA_class="lncRNA"
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /product="HOX transcript antisense RNA, transcript variant
                     1"
                     /db_xref="GeneID:100124700"
                     /db_xref="HGNC:HGNC:33510"
                     /db_xref="MIM:611400"
     exon            1..59
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       3
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1309834307"
     variation       13
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351002529"
     variation       20
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018086314"
     variation       21
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562612832"
     variation       22
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247268628"
     variation       23
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266257883"
     variation       24
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006738783"
     variation       29
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201533214"
     variation       32
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891049353"
     variation       34
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592196750"
     variation       35
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1210720503"
     variation       37
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029295719"
     variation       39
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254513611"
     variation       49
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425917096"
     variation       54
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951555584"
     variation       57
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372116912"
     variation       58
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447183691"
     exon            60..199
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       69
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343482934"
     variation       74
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918382727"
     variation       77
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973937487"
     variation       78
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212780552"
     variation       83
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000022974"
     variation       84
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748540504"
     variation       87
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902984322"
     variation       88
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439174192"
     variation       91
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306064006"
     variation       96
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367949505"
     variation       103
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222818557"
     variation       104
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548034593"
     variation       108
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318230854"
     variation       112
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567709233"
     variation       115
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014104080"
     variation       117
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467076531"
     variation       118
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298857007"
     variation       120
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195345858"
     variation       121
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895500914"
     variation       128
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055376129"
     variation       133
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219139761"
     variation       135
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779286783"
     variation       145
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532719220"
     variation       147
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888200177"
     variation       148
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768878421"
     variation       152
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955006633"
     variation       156
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325992702"
     variation       157
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235771740"
     variation       166
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441885167"
     variation       167
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277417318"
     variation       168
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73313155"
     variation       172
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292129413"
     variation       173
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332641018"
     variation       179
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930162795"
     variation       180
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988526299"
     variation       186
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437044161"
     variation       193
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202095733"
     variation       194
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041331363"
     variation       195
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439108082"
     variation       199
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911248229"
     exon            200..325
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       200
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565712233"
     variation       201
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329546185"
     variation       206
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:953811310"
     variation       208
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234548857"
     variation       210
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1200608043"
     variation       212
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921022139"
     variation       214
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227119229"
     variation       217
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1270538548"
     variation       220
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185191474"
     variation       228
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:979166715"
     variation       229
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575388178"
     variation       230
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264901644"
     variation       232
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968635023"
     variation       248..251
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1373881181"
     variation       248
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031125648"
     variation       249
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999089999"
     variation       250
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968611548"
     variation       261
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021944010"
     variation       269
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1012804975"
     variation       270
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460485412"
     variation       272
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1360941798"
     variation       273
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894117487"
     variation       274
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388893739"
     variation       276
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592193641"
     variation       277
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192969443"
     variation       290
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303930872"
     variation       291
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592193633"
     variation       296
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035016253"
     variation       297..300
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1592193630"
     variation       298
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002532600"
     variation       303
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408008611"
     variation       304
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:905150341"
     variation       311
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897560525"
     variation       312
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1264016274"
     variation       317
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358089944"
     variation       324
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222809808"
     exon            326..427
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       328
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236730164"
     variation       335
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757175770"
     variation       341
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555670580"
     variation       346
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199493539"
     variation       355
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:916649958"
     variation       370
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251078152"
     variation       376..391
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ggggagtggggagtgg"
                     /replace="ggggagtggggagtggggagtgg"
                     /db_xref="dbSNP:1364195419"
     variation       379
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592193256"
     variation       386
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471555649"
     variation       389
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592193253"
     variation       391
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:990887196"
     variation       395
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987576454"
     variation       401
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337982628"
     variation       403
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954774061"
     variation       411
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534252584"
     variation       416
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996698437"
     variation       418
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:964177234"
     variation       419
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395117843"
     variation       420
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022229524"
     variation       426
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1166375692"
     exon            428..551
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       437
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044397783"
     variation       439
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469560725"
     variation       442..444
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:954658987"
     variation       451
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453760897"
     variation       454
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319537838"
     variation       463
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190087427"
     variation       466
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010887847"
     variation       481..491
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="gaccagaaatg"
                     /db_xref="dbSNP:1257025536"
     variation       490
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383452611"
     variation       491
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975206638"
     variation       495
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221647373"
     variation       502
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208959780"
     variation       506
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551007666"
     variation       509
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867620883"
     variation       525
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241814553"
     variation       527
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055104380"
     variation       533..534
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1010845288"
     variation       533
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188410313"
     variation       534
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939443294"
     variation       542
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480111840"
     variation       547
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956621629"
     variation       551
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529367168"
     exon            552..2368
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       553
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333033817"
     variation       554
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954591197"
     variation       555
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164939890"
     variation       557
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021265875"
     variation       558
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894551180"
     variation       561
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341702164"
     variation       564
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1009500773"
     variation       575
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1250674043"
     variation       576
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192529"
     variation       580
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183607878"
     variation       586
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893440759"
     variation       590
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017398932"
     variation       605..614
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="agagagag"
                     /replace="agagagagag"
                     /db_xref="dbSNP:1200046963"
     variation       611
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260288344"
     variation       612
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1053388018"
     variation       620
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536505412"
     variation       621
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192524"
     variation       622
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425573283"
     variation       624
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904946081"
     variation       625
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428952127"
     variation       626
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565711253"
     variation       628
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046162992"
     variation       633
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423534587"
     variation       639
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247168509"
     variation       640
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949567501"
     variation       641
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908729786"
     variation       650
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929197676"
     variation       654
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592192516"
     variation       656
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867710570"
     variation       659
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469709663"
     variation       662
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778772853"
     variation       663
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396099510"
     variation       664
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756827347"
     variation       666
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753712445"
     variation       674
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901530450"
     variation       678
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931583861"
     variation       682
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331693259"
     variation       683
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253717777"
     variation       694
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209261817"
     variation       699
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200062893"
     variation       702..704
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:869293596"
     variation       703
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:111434707"
     variation       703
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:763855108"
     variation       703
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17840857"
     variation       704..706
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:201299570"
     variation       707
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975401876"
     variation       711
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547139015"
     variation       712
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:942706628"
     variation       720
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191759592"
     variation       724
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912632199"
     variation       737
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1484316451"
     variation       745
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341984552"
     variation       751
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:990281857"
     variation       758..763
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1565711221"
     variation       764..767
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1487608632"
     variation       764..765
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1372303428"
     variation       764
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187384923"
     variation       773
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196424288"
     variation       775
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592192481"
     variation       776
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424795327"
     variation       777
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432911935"
     variation       779
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565711206"
     variation       782..783
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1323683620"
     variation       783
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173596255"
     variation       785
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954670712"
     variation       786
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1466145508"
     variation       789
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358025452"
     variation       798
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020795065"
     variation       801
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592192465"
     variation       810
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988424649"
     variation       812
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344704354"
     variation       824
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217260946"
     variation       825
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299517387"
     variation       832
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314143535"
     variation       841
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234177164"
     variation       844
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557438483"
     variation       848
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351519751"
     variation       850
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756103880"
     variation       851
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763629259"
     variation       852
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971616067"
     variation       856
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488399670"
     variation       867
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189831317"
     variation       876
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192446"
     variation       879
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192445"
     variation       880
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169346978"
     variation       883
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565711170"
     variation       884
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429994691"
     variation       885
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024758974"
     variation       887
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433417836"
     variation       888
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032257118"
     variation       890
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762563705"
     variation       891
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377973258"
     variation       892
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001814400"
     variation       896
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535935865"
     variation       897
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017039103"
     variation       898
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1349222122"
     variation       899
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192426"
     variation       900..902
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:951889973"
     variation       901
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005612419"
     variation       902..909
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="cggctcgg"
                     /replace="cggctcggctcgg"
                     /db_xref="dbSNP:1219927663"
     variation       903
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026136414"
     variation       904
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387592952"
     variation       907
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545965699"
     variation       908..909
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /replace="ctcc"
                     /db_xref="dbSNP:201948416"
     variation       908
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7958904"
     variation       909
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287439853"
     variation       910
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759916627"
     variation       914
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887233959"
     variation       919
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488984158"
     variation       923..929
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccacacc"
                     /replace="ccacaccacacc"
                     /db_xref="dbSNP:888749359"
     variation       924
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177678547"
     variation       925
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235944994"
     variation       927
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192395"
     variation       929
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252735419"
     variation       930
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441073401"
     variation       931
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054161080"
     variation       932
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196611429"
     variation       935
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935734380"
     variation       941
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350272625"
     variation       954
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924819030"
     variation       959
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047222833"
     variation       965
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1838169"
     variation       969..970
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:531203390"
     variation       973
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310090131"
     variation       982
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378482880"
     variation       983
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542209426"
     variation       987
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227130335"
     variation       990
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574785476"
     variation       997
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:553393371"
     variation       1002
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315411296"
     variation       1004
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60674771"
     variation       1012..1016
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:958748523"
     variation       1015
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040003410"
     variation       1016
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:942652708"
     variation       1021
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255824088"
     variation       1024
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912579640"
     variation       1030
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909862812"
     variation       1033
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330235164"
     variation       1036
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471493830"
     variation       1037
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987256220"
     variation       1038
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577388608"
     variation       1039
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984230776"
     variation       1043
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369502915"
     variation       1052
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74348153"
     variation       1053
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951440399"
     variation       1054
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946156788"
     variation       1055..1057
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1026187033"
     variation       1056..1066
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccgctcagccg"
                     /replace="ccgctcagccgctcagccg"
                     /db_xref="dbSNP:1191516592"
     variation       1058
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913345903"
     variation       1062
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192336"
     variation       1064
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993339142"
     variation       1065
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868156619"
     variation       1066
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1018874795"
     variation       1066
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141850773"
     variation       1068
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1007876110"
     variation       1069
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276702650"
     variation       1073
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171981971"
     variation       1076
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957896168"
     variation       1078
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032204756"
     variation       1080..1085
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1565711061"
     variation       1086
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192320"
     variation       1088
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:536808709"
     variation       1097
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277448355"
     variation       1098..1106
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="taatt"
                     /replace="taattaatt"
                     /db_xref="dbSNP:1237498650"
     variation       1099
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182560442"
     variation       1101
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:569944537"
     variation       1106
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773201616"
     variation       1112
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487925940"
     variation       1115
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1472406939"
     variation       1120
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1425538782"
     variation       1128
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249943809"
     variation       1133
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181740093"
     variation       1134
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486237833"
     variation       1135
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592192294"
     variation       1137
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192291"
     variation       1140
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1278358509"
     variation       1141
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199248163"
     variation       1142
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192285"
     variation       1143
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412896617"
     variation       1149
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536546782"
     variation       1150
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353395309"
     variation       1151
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192278"
     variation       1154
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377235669"
     variation       1161
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024643404"
     variation       1169
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399963842"
     variation       1170
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296832719"
     variation       1180
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280806267"
     variation       1181
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013707331"
     variation       1182
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192272"
     variation       1192
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373913062"
     variation       1200
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950262255"
     variation       1201
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280463879"
     variation       1205..1209
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1352275715"
     variation       1210
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546974474"
     variation       1216
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214424850"
     variation       1226
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349299764"
     variation       1229
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:917378331"
     variation       1235
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189376086"
     variation       1239
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995655370"
     variation       1245
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564610577"
     variation       1247
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244706446"
     variation       1248
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416226724"
     variation       1249
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056081367"
     variation       1250..1257
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aag"
                     /replace="aaggaaag"
                     /db_xref="dbSNP:1592192245"
     variation       1258
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359592266"
     variation       1259
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395791276"
     variation       1262
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17720428"
     variation       1263
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157422478"
     variation       1265
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039949207"
     variation       1271
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362996876"
     variation       1272
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401705657"
     variation       1278
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592192226"
     variation       1282
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323320284"
     variation       1283
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412712583"
     variation       1286..1291
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ca"
                     /replace="caaaca"
                     /db_xref="dbSNP:1438203339"
     variation       1292
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565710983"
     variation       1293
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:530961052"
     variation       1298
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375572746"
     variation       1306
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237320952"
     variation       1315
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1288149388"
     variation       1319
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192215"
     variation       1320
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351326811"
     variation       1321
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209099344"
     variation       1329
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287504215"
     variation       1333
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:909925773"
     variation       1334
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12312094"
     variation       1336
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439233122"
     variation       1346
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176838793"
     variation       1347
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051101391"
     variation       1350
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:542198492"
     variation       1353
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409834772"
     variation       1354
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946073278"
     variation       1356
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:552406812"
     variation       1356
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918678641"
     variation       1361
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530402572"
     variation       1365
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1407403780"
     variation       1374
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377691358"
     variation       1375
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054973538"
     variation       1379..1381
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:36075637"
     variation       1385
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1326250742"
     variation       1386
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184960732"
     variation       1390
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936486557"
     variation       1392
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192178"
     variation       1393
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449263047"
     variation       1397
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285618780"
     variation       1401
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986104662"
     variation       1410
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925132966"
     variation       1429
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192169"
     variation       1431
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244001226"
     variation       1432
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953406981"
     variation       1434
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577428774"
     variation       1440
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201059190"
     variation       1444
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592192161"
     variation       1445
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980614936"
     variation       1446
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192156"
     variation       1448
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:969273430"
     variation       1450
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274099645"
     variation       1453
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327934059"
     variation       1454
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457491972"
     variation       1455
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032854056"
     variation       1457
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773650430"
     variation       1458
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234766735"
     variation       1462
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769579512"
     variation       1469
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020006991"
     variation       1471
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367232604"
     variation       1475
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474011970"
     variation       1476
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379385708"
     variation       1477
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423275180"
     variation       1482
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192133"
     variation       1490
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014410307"
     variation       1491
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143161957"
     variation       1504
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1025368737"
     variation       1507
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995267561"
     variation       1518
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543608618"
     variation       1521
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780157367"
     variation       1523
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770014270"
     variation       1534
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018457824"
     variation       1537
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342176687"
     variation       1541
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233757879"
     variation       1545
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192112"
     variation       1549
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1456637137"
     variation       1554
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315784541"
     variation       1555
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937642111"
     variation       1560
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386552179"
     variation       1563
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481039808"
     variation       1568
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199930403"
     variation       1570
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007104829"
     variation       1573
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1048639846"
     variation       1575
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192099"
     variation       1578
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189217352"
     variation       1584
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262948942"
     variation       1589
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477032746"
     variation       1591
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172421079"
     variation       1612
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929980330"
     variation       1613
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891370538"
     variation       1616
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161647261"
     variation       1617
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170306476"
     variation       1620
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192090"
     variation       1621
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745603728"
     variation       1623
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976884915"
     variation       1624
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192082"
     variation       1625
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297485089"
     variation       1630
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338200010"
     variation       1636
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192075"
     variation       1637
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1401614939"
     variation       1638
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:576206070"
     variation       1642
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298075397"
     variation       1651
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476619679"
     variation       1656
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010222121"
     variation       1657
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:534309238"
     variation       1658
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308315511"
     variation       1664
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565710841"
     variation       1669
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891812143"
     variation       1675
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554742485"
     variation       1677
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139288906"
     variation       1688
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212286165"
     variation       1689
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944115356"
     variation       1707
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463880452"
     variation       1713
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487549130"
     variation       1718
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911761187"
     variation       1722
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986377071"
     variation       1723
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245693827"
     variation       1724
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192057"
     variation       1729
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1223080018"
     variation       1739
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262792108"
     variation       1740
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432236427"
     variation       1750
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:936097552"
     variation       1752
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192050"
     variation       1753
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196252163"
     variation       1755
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396416026"
     variation       1757
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953175546"
     variation       1758
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927420453"
     variation       1761
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565619013"
     variation       1766
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145860004"
     variation       1771
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142098625"
     variation       1776
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992503794"
     variation       1777
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366597313"
     variation       1784
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757226391"
     variation       1785
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537392970"
     variation       1788
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373336565"
     variation       1790
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895547985"
     variation       1800
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918254795"
     variation       1801
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1352163599"
     variation       1803
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218473289"
     variation       1807
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261709666"
     variation       1811
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1565710786"
     variation       1811
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:571012711"
     variation       1817
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207744928"
     variation       1818
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254493189"
     variation       1819
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328042506"
     variation       1823
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1177482763"
     variation       1823
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751492661"
     variation       1826
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437330587"
     variation       1838
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420841549"
     variation       1841
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:180939821"
     variation       1849
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349136360"
     variation       1851
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163014526"
     variation       1852
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456170251"
     variation       1854
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324215384"
     variation       1868
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396938683"
     variation       1872
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1048691635"
     variation       1876
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930191397"
     variation       1882
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018072426"
     variation       1884
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226029274"
     variation       1885
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168304186"
     variation       1886
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448240105"
     variation       1887
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219814039"
     variation       1890
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571976806"
     variation       1905
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1468645201"
     variation       1906
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197577538"
     variation       1907
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955755349"
     variation       1913
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481314907"
     variation       1914
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177749242"
     variation       1916..1917
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1412972039"
     variation       1918
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029893766"
     variation       1924
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041432837"
     variation       1925
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166841389"
     variation       1934
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418216768"
     variation       1937
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462191032"
     variation       1941
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330872135"
     variation       1946
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757922994"
     variation       1952
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444461420"
     variation       1956
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299307304"
     variation       1962
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379104546"
     variation       1965..1972
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1335850402"
     variation       1971..1972
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:33918810"
     variation       1972..1973
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="ac"
                     /replace="c"
                     /replace="ctcagcagatggagattaccattcccaatagaaaaaaaac"
                     /db_xref="dbSNP:3839967"
     variation       1972..1973
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:869193878"
     variation       1972..1973
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="at"
                     /replace="c"
                     /db_xref="dbSNP:1555179144"
     variation       1972
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200349340"
     variation       1975
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911298009"
     variation       1976
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218937922"
     variation       1980
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:985538057"
     variation       1995
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752299278"
     variation       2008
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:3839968"
     variation       2008
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:779678471"
     variation       2008
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199717584"
     variation       2011
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257989884"
     variation       2014
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477356826"
     variation       2015
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170321747"
     variation       2018
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417626890"
     variation       2020
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305599084"
     variation       2025
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171228761"
     variation       2026
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358607991"
     variation       2031
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219723304"
     variation       2036..2037
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1413499618"
     variation       2038
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367073806"
     variation       2039..2043
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1291788494"
     variation       2050
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444652767"
     variation       2057
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764888962"
     variation       2061
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315327246"
     variation       2068
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356547994"
     variation       2071
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2366152"
     variation       2074
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307621641"
     variation       2075..2088
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="attt"
                     /replace="atttcaatgtattt"
                     /db_xref="dbSNP:1377643870"
     variation       2081
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268108497"
     variation       2082
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341054097"
     variation       2084
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1044481243"
     variation       2086
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214722122"
     variation       2088
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428280012"
     variation       2091
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560050858"
     variation       2092
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212994142"
     variation       2094
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912930772"
     variation       2096..2117
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="acacagtatgtatataaacaca"
                     /replace="acacagtatgtatataaacacagtatgtatataaacaca"
                     /db_xref="dbSNP:574452187"
     variation       2096
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487874849"
     variation       2097
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177510527"
     variation       2100
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1191258662"
     variation       2101
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541444610"
     variation       2104
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476531777"
     variation       2106
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187283078"
     variation       2107
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532504818"
     variation       2111
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424612552"
     variation       2114
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754219999"
     variation       2117
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432908759"
     variation       2123
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376579311"
     variation       2126
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866572114"
     variation       2128
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929884448"
     variation       2130
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:565281087"
     variation       2137
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473385455"
     variation       2142
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918547728"
     variation       2154
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766816108"
     variation       2164
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273853479"
     variation       2166
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203970931"
     variation       2173
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973726957"
     variation       2179
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745409441"
     variation       2180
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235837226"
     variation       2185
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001264122"
     variation       2187
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592191842"
     variation       2188
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352909321"
     variation       2191
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761309417"
     variation       2193..2196
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1203270825"
     variation       2201
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773752738"
     variation       2203
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210730449"
     variation       2204
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985634864"
     variation       2206
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447344953"
     variation       2210
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543594797"
     variation       2221
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311472860"
     variation       2224
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246340667"
     variation       2225
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452721105"
     variation       2230
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030253094"
     variation       2238
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195592745"
     variation       2246
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1395696310"
     variation       2248
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439651541"
     variation       2254
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772107865"
     variation       2256
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157287769"
     variation       2265
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370220472"
     variation       2273
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989039856"
     variation       2283
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1391858425"
     variation       2284
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994453010"
     variation       2292
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375454291"
     variation       2296
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236852759"
     variation       2299
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281182840"
     variation       2301..2302
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="caagg"
                     /db_xref="dbSNP:1351214496"
     variation       2302
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553391907"
     variation       2304
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554496458"
     variation       2307
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761884512"
     variation       2315..2326
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tgtgtgtgtg"
                     /replace="tgtgtgtgtgtg"
                     /replace="tgtgtgtgtgtgtg"
                     /db_xref="dbSNP:1008663091"
     variation       2318
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041260767"
     variation       2321
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566536199"
     variation       2330
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215739843"
     variation       2334
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026705186"
     variation       2339..2347
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ataaa"
                     /replace="ataaataaa"
                     /db_xref="dbSNP:879481932"
     regulatory      2342..2347
                     /regulatory_class="polyA_signal_sequence"
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
     variation       2342..2346
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:879919356"
     variation       2344..2349
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="t"
                     /replace="taaagt"
                     /db_xref="dbSNP:936741607"
     variation       2344
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:534879867"
     variation       2344
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111294925"
     variation       2346..2349
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="aagt"
                     /db_xref="dbSNP:552357611"
     variation       2348..2349
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:879383432"
     variation       2354
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137995449"
     variation       2355
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377657236"
     variation       2358
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905889573"
     variation       2360
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546692438"
     variation       2367
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014761939"
     polyA_site      2368
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
ORIGIN      
ccagttctcaggcgagagccgcggctgacagggtctgggacagaaggaaagccctccagcctccaggccctgccttctgcctgcacattctgccctgatttccggaacctggaagcctaggcaggcagtggggaactctgactcgcctgtgctctggagcttgatccgaaagcttccacagtgaggactgctccgtgggggtaagagagcaccaggcactgaggcctgggagttccacagaccaacacccctgctcctggcggctcccacccgggacttagaccctcaggtccctaatatcccggaggtgctctcaatcagaaaggtcctgctccgcttcgcagtggaatggaacggatttagaagcctgcagtaggggagtggggagtggagagagggagcccagagttacagacggcggcgagaggaaggaggggcgtctttatttttttaaggccccaaagagtctgatgtttacaagaccagaaatgccacggccgcgtcctggcagagaaaaggctgaaatggaggaccggcgccttccttataagctcgttggggcctaagccagtaccgacctggtagaaaaagcaaccacgaagctagagagagagccagaggagggaagagagcgccagacgaaggtgaaagcgaaccacgcagagaaatgcaggcaagggagcaaggcggcagttcccggaacaaacgtggcagagggcaagacgggcactcacagacagaggtttatgtatttttattttttaaaatctgatttggtgttccatgaggaaaagggaaaatctagggaacgggagtacagagagaataatccgggtcctagctcgccacatgaacgcccagagaacgctggaaaaacctgagcgggtgccggggcagcacccggctcgggtcagccactgccccacaccgggcccaccaagccccgcccctcgcggccaccggggcttccttgctcttcttatcatctccatctttatgatgaggcttgttaacaagaccagagagctggccaagcacctctatctcagccgcgcccgctcagccgagcagcggtcggtggggggactgggaggcgctaattaattgattcctttggactgtaaaatatggcggcgtctacacggaacccatggactcataaacaatatatctgttgggcgtgagtgcactgtctctcaaataatttttccataggcaaatgtcagagggttctggatttttagttgctaaggaaagatccaaatgggaccaattttaggaggcccaaacagagtccgttcagtgtcagaaaatgcttccccaaaggggttgggagtgtgttttgttggaaaaaagcttgggttataggaaagcctttccctgctacttgtgtagacccagcccaatttaagaattacaaggaagcgaaggggttgtgtaggccggaagcctctctgtcccggctggatgcaggggacttgagctgctccggaatttgagaggaacatagaagcaaaggtccagcctttgcttcgtgctgattcctagacttaagattcaaaaacaaatttttaaaagtgaaaccagccctagcctttggaagctcttgaaggttcagcacccacccaggaatccacctgcctgttacacgcctctccaagacacagtggcaccgcttttctaactggcagcacagagcaactctataatatgcttatattaggtctagaagaatgcatcttgagacacatgggtaacctaattatataatgcttgttccatacaggagtgattatgcagtgggaccctgctgcaaacgggactttgcactctaaatatagaccccagcttgggacaaaagttgcagtagaaaaatagacataggagaacacttaaataagtgatgcatgtagacacagaaggggtatttaaaagacagaaataatagaagtacagaagaacagaaaaaaaatcagcagatggagattaccattcccaatgcctgaacttcctcctgctattaagattgctagagaattgtgtcttaaacagttcatgaacccagaagaatgcaatttcaatgtatttagtacacacacagtatgtatataaacacaactcacagaatatattttccatacattgggtaggtatgcactttgtgtatatataataatgtattttccatgcagttttaaaatgtagatatattaatatctggatgcattttctgtgcactggttttatatgccttatggagtatatactcacatgtagctaaatagactcaggactgcacattccttgtgtaggttgtgtgtgtgtggtggttttatgcataaataaagttttacatgtggtgaatataaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]