GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:30:37, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_046621               1101 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens KCNQ5 antisense RNA 1 (KCNQ5-AS1), long non-coding
            RNA.
ACCESSION   NR_046621
VERSION     NR_046621.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     PREDICTED REFSEQ: This record has not been reviewed and the
            function is unknown. The reference sequence was derived from
            AL365232.24.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-89                AL365232.24        10315-10403         c
            90-217              AL365232.24        3522-3649           c
            218-810             AL365232.24        2456-3048           c
            811-876             AL365232.24        2176-2241           c
            877-1101            AL365232.24        1692-1916           c
FEATURES             Location/Qualifiers
     source          1..1101
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q13"
     gene            1..1101
                     /gene="KCNQ5-AS1"
                     /note="KCNQ5 antisense RNA 1"
                     /db_xref="GeneID:100873997"
                     /db_xref="HGNC:HGNC:40323"
     ncRNA           1..1101
                     /ncRNA_class="lncRNA"
                     /gene="KCNQ5-AS1"
                     /product="KCNQ5 antisense RNA 1"
                     /db_xref="GeneID:100873997"
                     /db_xref="HGNC:HGNC:40323"
     exon            1..89
                     /gene="KCNQ5-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351059307"
     variation       16
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867361222"
     variation       20
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281062661"
     variation       21
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528982055"
     variation       22
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:941894875"
     variation       24
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016464204"
     variation       27
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047670810"
     variation       40
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349462053"
     variation       46
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013065907"
     variation       48
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894732061"
     variation       49
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780116996"
     variation       50
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282843032"
     variation       55
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756310357"
     variation       64
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449235045"
     variation       65
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45513596"
     variation       68
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252465780"
     variation       69
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406195722"
     variation       70
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190139410"
     variation       71..73
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1395888027"
     variation       78
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041687662"
     variation       79
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401810073"
     variation       87
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011642516"
     variation       89
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157183980"
     exon            90..217
                     /gene="KCNQ5-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       91
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183917471"
     variation       93
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436065550"
     variation       95
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:967813676"
     variation       98..105
                     /gene="KCNQ5-AS1"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1210251532"
     variation       100
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1418642322"
     variation       104
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11753344"
     variation       108
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570732875"
     variation       111..117
                     /gene="KCNQ5-AS1"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1329300531"
     variation       113
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398050915"
     variation       114
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411388841"
     variation       123..128
                     /gene="KCNQ5-AS1"
                     /replace="tccagt"
                     /replace="tccagtccagt"
                     /db_xref="dbSNP:1232108786"
     variation       124
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894584944"
     variation       134..135
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1294797097"
     variation       138
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773261342"
     variation       139
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771480387"
     variation       143
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237519031"
     variation       148
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342096026"
     variation       150
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196956095"
     variation       156
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1278351690"
     variation       158
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441100826"
     variation       159
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1190285469"
     variation       167
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335729002"
     variation       177
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477507292"
     variation       178
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990661162"
     variation       184
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:951783237"
     variation       191
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:945033161"
     variation       198
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1018135187"
     variation       200
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1301743553"
     variation       202
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1392508059"
     variation       205
                     /gene="KCNQ5-AS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1401207472"
     variation       209
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412577862"
     exon            218..810
                     /gene="KCNQ5-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       218
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243509495"
     variation       220
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199497955"
     variation       221
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149112665"
     variation       225
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2796051"
     variation       231
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188051922"
     variation       232
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558628397"
     variation       233
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138112960"
     variation       234
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427243847"
     variation       241
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958704392"
     variation       247
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355444421"
     variation       250
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033067276"
     variation       266
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538524080"
     variation       273
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229672950"
     variation       278
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1415408368"
     variation       279
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341678655"
     variation       280
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1360030633"
     variation       284
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212716048"
     variation       288
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:907402702"
     variation       289
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307820816"
     variation       292
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1209190569"
     variation       294
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903291679"
     variation       295
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486445862"
     variation       297
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045851103"
     variation       303
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268672287"
     variation       313
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758651049"
     variation       316
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1020858522"
     variation       318
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1188760215"
     variation       321
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946306237"
     variation       322
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420872119"
     variation       324
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432904279"
     variation       328
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187544158"
     variation       333
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397349801"
     variation       335
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901430991"
     variation       336
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343480030"
     variation       338
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1039935516"
     variation       349
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054869836"
     variation       350
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73454729"
     variation       352
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233561180"
     variation       353
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:911218884"
     variation       361
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536071644"
     variation       362
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766266556"
     variation       363
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568512804"
     variation       367
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571542743"
     variation       368
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373609910"
     variation       369
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283153992"
     variation       371
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934046806"
     variation       379
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217324365"
     variation       381
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243129213"
     variation       382
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488439945"
     variation       387
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172728187"
     variation       390
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1562200053"
     variation       397
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192371698"
     variation       398
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549839735"
     variation       407
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1255263378"
     variation       415
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922448171"
     variation       416
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158234135"
     variation       418
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406091240"
     variation       424
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402464379"
     variation       427
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159918667"
     variation       430
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760588563"
     variation       432
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972557913"
     variation       438
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036594322"
     variation       441
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961591551"
     variation       444
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546848344"
     variation       447
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016890790"
     variation       448
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430197848"
     variation       449
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1421112894"
     variation       452
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165801324"
     variation       457
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528284288"
     variation       458
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537983120"
     variation       459
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772995572"
     variation       470
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1474913577"
     variation       485
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949919061"
     variation       494
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917139669"
     variation       510
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767542687"
     variation       517
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991419569"
     variation       521..522
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1333583426"
     variation       524
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212335449"
     variation       525..526
                     /gene="KCNQ5-AS1"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1275636480"
     variation       539
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1469149037"
     variation       547
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984434398"
     variation       552
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257461855"
     variation       561
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377314140"
     variation       570
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925926237"
     variation       571
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761678904"
     variation       574
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033287341"
     variation       575
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552157306"
     variation       577
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1214199694"
     variation       588
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020407199"
     variation       598
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396611505"
     variation       613
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357370011"
     variation       616
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:906264794"
     variation       617
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1295179687"
     variation       634
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333828555"
     variation       635
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1562199920"
     variation       638
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024903298"
     variation       639
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772376462"
     variation       641
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312201141"
     variation       651
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442588866"
     variation       662
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018452495"
     variation       663
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1230949682"
     variation       670
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762211460"
     variation       674
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356046168"
     variation       676
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326689614"
     variation       681
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336116253"
     variation       686
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195786561"
     variation       689
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:891958970"
     variation       697
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054749270"
     variation       698
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936225483"
     variation       699
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183441393"
     variation       707
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762536674"
     variation       714
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408983946"
     variation       718..720
                     /gene="KCNQ5-AS1"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1007113370"
     variation       721
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205437322"
     variation       723
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775040964"
     variation       728
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888720661"
     variation       733
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166408996"
     variation       734
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7772526"
     variation       748
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:994544769"
     variation       762
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:897532572"
     variation       769
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475489042"
     variation       774
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113453470"
     variation       782
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167317097"
     variation       784
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036123427"
     variation       799
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411485275"
     variation       801
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9446848"
     variation       802
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:917107001"
     variation       804
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:530536654"
     variation       806
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355595306"
     variation       810
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780621884"
     exon            811..876
                     /gene="KCNQ5-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       822
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176943960"
     variation       824
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336374188"
     variation       825
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926303891"
     variation       827
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454983979"
     variation       839
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554588190"
     variation       853
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543075039"
     variation       858
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191966334"
     variation       859
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752967113"
     variation       860
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268824440"
     variation       862
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1265784092"
     variation       864
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994879664"
     variation       865
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180992100"
     variation       872
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252264244"
     variation       874
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472602491"
     variation       876
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036499733"
     exon            877..1101
                     /gene="KCNQ5-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       886
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926503450"
     variation       887..889
                     /gene="KCNQ5-AS1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1322516634"
     variation       887
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530467919"
     variation       889
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563072007"
     variation       896
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365613138"
     variation       901
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439910865"
     variation       908
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867366828"
     variation       921
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551201992"
     variation       926
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1369280841"
     variation       930
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219504292"
     variation       935
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282910607"
     variation       937
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913545349"
     variation       938
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945966009"
     variation       943
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269344398"
     variation       947
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987932347"
     variation       977
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192156162"
     variation       981
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255363890"
     variation       991
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:573893601"
     variation       1004
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405847459"
     variation       1021
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420990704"
     variation       1025
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383352914"
     variation       1027
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041014745"
     variation       1031
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359235974"
     variation       1032
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944079433"
     variation       1037
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1323627729"
     variation       1040
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1287846804"
     variation       1046
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532202630"
     variation       1048
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351451438"
     variation       1052
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377852242"
     variation       1053
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1562199297"
     variation       1054
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172114474"
     variation       1055
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911265098"
     variation       1071
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370473471"
     variation       1072
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958004825"
     variation       1073
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985525470"
     variation       1083
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033195593"
     variation       1087
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334767580"
     variation       1088..1092
                     /gene="KCNQ5-AS1"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1292444598"
     variation       1091
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212434352"
     variation       1093
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452588490"
     variation       1094
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204047559"
     variation       1096
                     /gene="KCNQ5-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564986079"
     variation       1098
                     /gene="KCNQ5-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484038223"
     variation       1101
                     /gene="KCNQ5-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1182982299"
ORIGIN      
gtgaaagtggaaaagaaacagtgggaggaatgagaggcaagaagcagcgggtagcacttttctcggtatcaaagagacgtgaaactaggctacttaattttttttcttgtaaaaaaagaacttccagtttcccaagacgcaacattgaattcaatcagaggtaaagattctggactattggattaaatgaggaggcaggagctactatctcttgcagtgtgaaaccagggccggggatgaagatatggacacatctcagctttccagggatgctgtgatgtgggtgagcatgagctttgtctatgggctgaattgcatccctccaaaattcatatgttatggtcctaacccctagtacctccgaatgcgactgtttggagatagggtctttagagatgttattaaattaaaatgaggttattagagtggctcctaatccaatatgattggtatccttataagtagaggaaatttgcacatggctgggtacagagaaaagtctatgtaaagactcagggagaagaccatctaaagccaagaagaaagccttcagaaggaaccaaccctgctgacaccttaaacttggccttctagcctctagactgtgagaaaataaatttttgttgtttaaggcatctagtactttgttatagcagcttgagcaaactaatacaagttccatttgtagtagaagctattaaacatcattacatagtctatgtctgcactcaacaaagactggttcccaccattaagacaagctgctccttctaccacttgggaggaaatcagcttaaggaaaggtgttagaaatattaggaaatacagattaaaaaatgaagaaacaaaatataactgtgatctcaccactcaaagaaaggatgtacccatttatattcagcaagcctattttgagtgcaacataaagccctgtcactggtaactcttgactcagctgctcaagggctttcagccaaaatcctaggaggagagtgaggaaactagaggacactgaaaagctgtgccacaagtgactcagatcctgcaagtggctcgatggaggagtgtcccgtgttggtggcggaggtttttccttcctta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]