2024-05-06 13:17:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_039765 83 bp RNA linear PRI 03-SEP-2020 DEFINITION Homo sapiens microRNA 548an (MIR548AN), microRNA. ACCESSION NR_039765 VERSION NR_039765.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 83) AUTHORS Othumpangat S, Noti JD, Blachere FM and Beezhold DH. TITLE Expression of non-structural-1A binding protein in lung epithelial cells is modulated by miRNA-548an on exposure to influenza A virus JOURNAL Virology 447 (1-2), 84-94 (2013) PUBMED 24210102 REMARK GeneRIF: This study provided evidence that miRNA-548an is involved in the regulation of NS1ABP. REFERENCE 2 (bases 1 to 83) AUTHORS Randall JC, Winkler TW, Kutalik Z, Berndt SI, Jackson AU, Monda KL, Kilpelainen TO, Esko T, Magi R, Li S, Workalemahu T, Feitosa MF, Croteau-Chonka DC, Day FR, Fall T, Ferreira T, Gustafsson S, Locke AE, Mathieson I, Scherag A, Vedantam S, Wood AR, Liang L, Steinthorsdottir V, Thorleifsson G, Dermitzakis ET, Dimas AS, Karpe F, Min JL, Nicholson G, Clegg DJ, Person T, Krohn JP, Bauer S, Buechler C, Eisinger K, Bonnefond A, Froguel P, Hottenga JJ, Prokopenko I, Waite LL, Harris TB, Smith AV, Shuldiner AR, McArdle WL, Caulfield MJ, Munroe PB, Gronberg H, Chen YD, Li G, Beckmann JS, Johnson T, Thorsteinsdottir U, Teder-Laving M, Khaw KT, Wareham NJ, Zhao JH, Amin N, Oostra BA, Kraja AT, Province MA, Cupples LA, Heard-Costa NL, Kaprio J, Ripatti S, Surakka I, Collins FS, Saramies J, Tuomilehto J, Jula A, Salomaa V, Erdmann J, Hengstenberg C, Loley C, Schunkert H, Lamina C, Wichmann HE, Albrecht E, Gieger C, Hicks AA, Johansson A, Pramstaller PP, Kathiresan S, Speliotes EK, Penninx B, Hartikainen AL, Jarvelin MR, Gyllensten U, Boomsma DI, Campbell H, Wilson JF, Chanock SJ, Farrall M, Goel A, Medina-Gomez C, Rivadeneira F, Estrada K, Uitterlinden AG, Hofman A, Zillikens MC, den Heijer M, Kiemeney LA, Maschio A, Hall P, Tyrer J, Teumer A, Volzke H, Kovacs P, Tonjes A, Mangino M, Spector TD, Hayward C, Rudan I, Hall AS, Samani NJ, Attwood AP, Sambrook JG, Hung J, Palmer LJ, Lokki ML, Sinisalo J, Boucher G, Huikuri H, Lorentzon M, Ohlsson C, Eklund N, Eriksson JG, Barlassina C, Rivolta C, Nolte IM, Snieder H, Van der Klauw MM, Van Vliet-Ostaptchouk JV, Gejman PV, Shi J, Jacobs KB, Wang Z, Bakker SJ, Mateo Leach I, Navis G, van der Harst P, Martin NG, Medland SE, Montgomery GW, Yang J, Chasman DI, Ridker PM, Rose LM, Lehtimaki T, Raitakari O, Absher D, Iribarren C, Basart H, Hovingh KG, Hypponen E, Power C, Anderson D, Beilby JP, Hui J, Jolley J, Sager H, Bornstein SR, Schwarz PE, Kristiansson K, Perola M, Lindstrom J, Swift AJ, Uusitupa M, Atalay M, Lakka TA, Rauramaa R, Bolton JL, Fowkes G, Fraser RM, Price JF, Fischer K, Krjuta Kov K, Metspalu A, Mihailov E, Langenberg C, Luan J, Ong KK, Chines PS, Keinanen-Kiukaanniemi SM, Saaristo TE, Edkins S, Franks PW, Hallmans G, Shungin D, Morris AD, Palmer CN, Erbel R, Moebus S, Nothen MM, Pechlivanis S, Hveem K, Narisu N, Hamsten A, Humphries SE, Strawbridge RJ, Tremoli E, Grallert H, Thorand B, Illig T, Koenig W, Muller-Nurasyid M, Peters A, Boehm BO, Kleber ME, Marz W, Winkelmann BR, Kuusisto J, Laakso M, Arveiler D, Cesana G, Kuulasmaa K, Virtamo J, Yarnell JW, Kuh D, Wong A, Lind L, de Faire U, Gigante B, Magnusson PK, Pedersen NL, Dedoussis G, Dimitriou M, Kolovou G, Kanoni S, Stirrups K, Bonnycastle LL, Njolstad I, Wilsgaard T, Ganna A, Rehnberg E, Hingorani A, Kivimaki M, Kumari M, Assimes TL, Barroso I, Boehnke M, Borecki IB, Deloukas P, Fox CS, Frayling T, Groop LC, Haritunians T, Hunter D, Ingelsson E, Kaplan R, Mohlke KL, O'Connell JR, Schlessinger D, Strachan DP, Stefansson K, van Duijn CM, Abecasis GR, McCarthy MI, Hirschhorn JN, Qi L, Loos RJ, Lindgren CM, North KE and Heid IM. CONSRTM DIAGRAM Consortium; MAGIC Investigators TITLE Sex-stratified genome-wide association studies including 270,000 individuals show sexual dimorphism in genetic loci for anthropometric traits JOURNAL PLoS Genet. 9 (6), e1003500 (2013) PUBMED 23754948 REFERENCE 3 (bases 1 to 83) AUTHORS Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q, How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE, Chadburn A and Dave SS. CONSRTM Hematologic Malignancies Research Consortium TITLE Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs JOURNAL Blood 116 (23), e118-e127 (2010) PUBMED 20733160 REFERENCE 4 (bases 1 to 83) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AL590808.6. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-83 AL590808.6 95129-95211 FEATURES Location/Qualifiers source 1..83 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="X" /map="Xq22.3" gene 1..83 /gene="MIR548AN" /note="microRNA 548an" /db_xref="GeneID:100616144" /db_xref="HGNC:HGNC:41681" /db_xref="miRBase:MI0016907" precursor_RNA 1..83 /gene="MIR548AN" /product="microRNA 548an" /db_xref="GeneID:100616144" /db_xref="HGNC:HGNC:41681" /db_xref="miRBase:MI0016907" exon 1..83 /gene="MIR548AN" /inference="alignment:Splign:2.1.0" variation 2 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:770352111" variation 3 /gene="MIR548AN" /replace="c" /replace="t" /db_xref="dbSNP:1927461287" variation 6 /gene="MIR548AN" /replace="c" /replace="g" /db_xref="dbSNP:1927461397" variation 7 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:750633541" variation 8 /gene="MIR548AN" /replace="c" /replace="t" /db_xref="dbSNP:770802542" variation 10..22 /gene="MIR548AN" /replace="" /replace="ggtgcaaaaggca" /db_xref="dbSNP:763766728" variation 10 /gene="MIR548AN" /replace="g" /replace="t" /db_xref="dbSNP:1164456650" ncRNA 15..34 /ncRNA_class="miRNA" /gene="MIR548AN" /product="hsa-miR-548an" /db_xref="miRBase:MIMAT0019079" /db_xref="GeneID:100616144" /db_xref="HGNC:HGNC:41681" /db_xref="miRBase:MI0016907" variation 16 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:2147623980" variation 20 /gene="MIR548AN" /replace="g" /replace="t" /db_xref="dbSNP:1382172478" variation 21 /gene="MIR548AN" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1419571339" variation 22 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:1253225863" variation 25..82 /gene="MIR548AN" /replace="" /replace="gtggtttttgcctataaaagtaatggcaaaaaccgcaattccttttgc accaacctaa" /db_xref="dbSNP:1569425371" variation 26 /gene="MIR548AN" /replace="c" /replace="t" /db_xref="dbSNP:1299349049" variation 29 /gene="MIR548AN" /replace="g" /replace="t" /db_xref="dbSNP:759131879" variation 38 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:774319701" variation 40 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:1927462694" variation 44 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:1361824542" variation 57 /gene="MIR548AN" /replace="c" /replace="t" /db_xref="dbSNP:1927462928" variation 58 /gene="MIR548AN" /replace="c" /replace="t" /db_xref="dbSNP:775683373" variation 59 /gene="MIR548AN" /replace="a" /replace="g" /db_xref="dbSNP:1341261625" variation 64 /gene="MIR548AN" /replace="g" /replace="t" /db_xref="dbSNP:1247297052" variation 65 /gene="MIR548AN" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1267615527" variation 72 /gene="MIR548AN" /replace="c" /replace="t" /db_xref="dbSNP:1927463804" variation 74 /gene="MIR548AN" /replace="c" /replace="t" /db_xref="dbSNP:1927463984" variation 77 /gene="MIR548AN" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:760914245" ORIGIN
cattaggttggtgcaaaaggcattgtggtttttgcctataaaagtaatggcaaaaaccgcaattccttttgcaccaacctaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]