LOCUS       NR_039043                102 bp    RNA     linear   INV 10-MAY-2023
DEFINITION  Nasonia vitripennis microRNA mir-375 (Mir375), microRNA.
ACCESSION   NR_039043
VERSION     NR_039043.1
KEYWORDS    RefSeq.
SOURCE      Nasonia vitripennis (jewel wasp)
  ORGANISM  Nasonia vitripennis
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Proctotrupomorpha; Chalcidoidea; Pteromalidae; Pteromalinae;
            Nasonia.
REFERENCE   1  (bases 1 to 102)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from WELF01000002.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-102               WELF01000002.1     6810996-6811097     c
FEATURES             Location/Qualifiers
     source          1..102
                     /organism="Nasonia vitripennis"
                     /mol_type="transcribed RNA"
                     /strain="AsymCX"
                     /db_xref="taxon:7425"
                     /chromosome="5"
                     /map="5"
     gene            1..102
                     /gene="Mir375"
                     /gene_synonym="nvi-mir-375"
                     /note="microRNA mir-375"
                     /db_xref="GeneID:100526343"
                     /db_xref="miRBase:MI0014760"
     precursor_RNA   1..102
                     /gene="Mir375"
                     /gene_synonym="nvi-mir-375"
                     /product="microRNA mir-375"
                     /db_xref="GeneID:100526343"
                     /db_xref="miRBase:MI0014760"
     exon            1..102
                     /gene="Mir375"
                     /gene_synonym="nvi-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           65..86
                     /ncRNA_class="miRNA"
                     /gene="Mir375"
                     /gene_synonym="nvi-mir-375"
                     /product="nvi-miR-375"
                     /db_xref="miRBase:MIMAT0015699"
                     /db_xref="GeneID:100526343"
                     /db_xref="miRBase:MI0014760"
ORIGIN      

ctcagcaataggcttcacctggtccatcgatcccaacgatcaataaactgtgttattaaacaagtttgttcgttcggctcgagttattaggtgagccttgtc

//