GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:16:48, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_038454               1598 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens phosphoribosyl pyrophosphate synthetase 2 pseudogene
            (LOC100130673), non-coding RNA.
ACCESSION   NR_038454 XM_001723019 XM_001724384 XM_001724416 XM_002344269
VERSION     NR_038454.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     PREDICTED REFSEQ: This record has not been reviewed and the
            function is unknown. The reference sequence was derived from
            AC018641.3.
            On or before Jun 18, 2011 this sequence version replaced
            XM_001724384.2, XM_002344269.2, XM_001723019.2, XM_001724416.2.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1598              AC018641.3         84656-86253
FEATURES             Location/Qualifiers
     source          1..1598
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7p14.3"
     gene            1..1598
                     /gene="LOC100130673"
                     /note="phosphoribosyl pyrophosphate synthetase 2
                     pseudogene"
                     /pseudo
                     /db_xref="GeneID:100130673"
     misc_RNA        1..1598
                     /gene="LOC100130673"
                     /product="phosphoribosyl pyrophosphate synthetase 2
                     pseudogene"
                     /pseudo
                     /db_xref="GeneID:100130673"
     exon            1..1598
                     /gene="LOC100130673"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1562728451"
     variation       4
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981502682"
     variation       7
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547322764"
     variation       20
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149019481"
     variation       21
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970453488"
     variation       22
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022931466"
     variation       29
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037543077"
     variation       34
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368588670"
     variation       43
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194961454"
     variation       51
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:940502647"
     variation       69
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:184167275"
     variation       76
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1165836411"
     variation       81
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418375093"
     variation       86..91
                     /gene="LOC100130673"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:1165241103"
     variation       90
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405549123"
     variation       94
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764294813"
     variation       103
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1004326782"
     variation       106
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:890899590"
     variation       108
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051285204"
     variation       115
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328316921"
     variation       123
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428697210"
     variation       129
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1269622812"
     variation       132
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536455689"
     variation       135
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357890129"
     variation       138
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:981844170"
     variation       139
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1580024"
     variation       167..171
                     /gene="LOC100130673"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:899507250"
     variation       171
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916265331"
     variation       172
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218076884"
     variation       175..182
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="gcaagaag"
                     /db_xref="dbSNP:1190433742"
     variation       175
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286923137"
     variation       182
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990863918"
     variation       185
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1240939727"
     variation       187
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946636161"
     variation       201
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752800521"
     variation       205
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913806208"
     variation       211
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052289513"
     variation       217
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939162928"
     variation       226
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1580023"
     variation       227
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033640142"
     variation       228..232
                     /gene="LOC100130673"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1163891726"
     variation       231
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1413399868"
     variation       232
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398838485"
     variation       237
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317733432"
     variation       239
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341082914"
     variation       243
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454838324"
     variation       245
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970127350"
     variation       251
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382560185"
     variation       256
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915915087"
     variation       257
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419931422"
     variation       258
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349162468"
     variation       265
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204997625"
     variation       269
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283010762"
     variation       271
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461373516"
     variation       277
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000408378"
     variation       287
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205218849"
     variation       288
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:967514330"
     variation       307
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487927392"
     variation       308
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962961653"
     variation       311
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468548589"
     variation       314
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1242431936"
     variation       345
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:563934432"
     variation       347
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335033156"
     variation       361
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762908957"
     variation       363
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545930545"
     variation       375
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191987418"
     variation       383
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574714395"
     variation       384..412
                     /gene="LOC100130673"
                     /replace="cat"
                     /replace="cataagggaaggagtgaccaaaataacat"
                     /db_xref="dbSNP:1195963381"
     variation       385
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:890518229"
     variation       392
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:188786851"
     variation       395
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1580022"
     variation       397
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761691612"
     variation       401
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336213767"
     variation       402
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1029799061"
     variation       405
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1580021"
     variation       406
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224843158"
     variation       409
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556852521"
     variation       411..412
                     /gene="LOC100130673"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1043426653"
     variation       412
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:565953739"
     variation       414
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290972614"
     variation       424
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:899118771"
     variation       427
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010557477"
     variation       430
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892426098"
     variation       435
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174370683"
     variation       437
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10236344"
     variation       440
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:940533608"
     variation       445
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462737086"
     variation       452
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:907690166"
     variation       453
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373179610"
     variation       454
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170082746"
     variation       463
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324563972"
     variation       491
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347970482"
     variation       492
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:949130072"
     variation       502
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403569153"
     variation       505
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280825199"
     variation       508..513
                     /gene="LOC100130673"
                     /replace="tgt"
                     /replace="tgttgt"
                     /db_xref="dbSNP:1322202286"
     variation       508
                     /gene="LOC100130673"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1477431894"
     variation       508
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149841301"
     variation       517..518
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1420187789"
     variation       525
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044880662"
     variation       526
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337263981"
     variation       534
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:552795136"
     variation       536
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:948828761"
     variation       537
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245918470"
     variation       549
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:915983395"
     variation       556
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539548644"
     variation       571
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469553732"
     variation       574
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941363537"
     variation       575
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908833630"
     variation       576..582
                     /gene="LOC100130673"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1255558516"
     variation       603
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558965905"
     variation       609
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565752452"
     variation       610
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547092554"
     variation       611..623
                     /gene="LOC100130673"
                     /replace="ca"
                     /replace="cagccaggcccca"
                     /db_xref="dbSNP:1042971329"
     variation       620
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1298454585"
     variation       622..640
                     /gene="LOC100130673"
                     /replace="caaccc"
                     /replace="caacccacctctgcaaccc"
                     /db_xref="dbSNP:1367258997"
     variation       622
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366342842"
     variation       625
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957939531"
     variation       640
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779573699"
     variation       646
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304638845"
     variation       649
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324357656"
     variation       654
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1562728319"
     variation       655..662
                     /gene="LOC100130673"
                     /replace="caatggca"
                     /replace="caatggcaatggca"
                     /db_xref="dbSNP:1374989939"
     variation       657
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443311015"
     variation       669
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="ggggg"
                     /db_xref="dbSNP:148685605"
     variation       671
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926261967"
     variation       673
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022048970"
     variation       683
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220211356"
     variation       728
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290916015"
     variation       735
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978972630"
     variation       737
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772458906"
     variation       742
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462604104"
     variation       744
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355023542"
     variation       745
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77393551"
     variation       746
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008985000"
     variation       763
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184426653"
     variation       773
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387548514"
     variation       774
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561504569"
     variation       776
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423099357"
     variation       779
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76832647"
     variation       785
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194062638"
     variation       788
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455282091"
     variation       790
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045330375"
     variation       796
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1236039481"
     variation       798..799
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1384783095"
     variation       798
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764563248"
     variation       799
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996223721"
     variation       800
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:894604748"
     variation       805..815
                     /gene="LOC100130673"
                     /replace="gttgg"
                     /replace="gttggagttgg"
                     /db_xref="dbSNP:1252561296"
     variation       808
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480713684"
     variation       815
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1314058012"
     variation       817
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1217787940"
     variation       820
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259098796"
     variation       821
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757686099"
     variation       824
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037647317"
     variation       826
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12539807"
     variation       827
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281439597"
     variation       839
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442958594"
     variation       843
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1183403386"
     variation       850
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409092602"
     variation       855
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886326723"
     variation       857
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421453844"
     variation       864
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046272387"
     variation       869
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:949159805"
     variation       871
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342962546"
     variation       880
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456226219"
     variation       887
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336757851"
     variation       891
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563946459"
     variation       893
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1055275778"
     variation       894
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237009401"
     variation       895
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1374924300"
     variation       895
                     /gene="LOC100130673"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1373770936"
     variation       896
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936381478"
     variation       910
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225461783"
     variation       914
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304746919"
     variation       915
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224230165"
     variation       916
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982725887"
     variation       919
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460157797"
     variation       925
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934252079"
     variation       935
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550088213"
     variation       939
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481803396"
     variation       941
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176032970"
     variation       946
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301193286"
     variation       955
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545543754"
     variation       972
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1481026364"
     variation       975
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547807901"
     variation       977..980
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="gcag"
                     /db_xref="dbSNP:1374816374"
     variation       993
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1562728242"
     variation       998
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:964234511"
     variation       1007
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174910775"
     variation       1010
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354938219"
     variation       1011
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946316412"
     variation       1013
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444085150"
     variation       1016
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:913445249"
     variation       1020
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349832204"
     variation       1028
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355597651"
     variation       1035
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022434741"
     variation       1059
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285293792"
     variation       1064
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344813937"
     variation       1068
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3801331"
     variation       1074
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756312342"
     variation       1090
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1218901245"
     variation       1091
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273945995"
     variation       1092
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309431790"
     variation       1097
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3801330"
     variation       1099
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251459169"
     variation       1101
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490660020"
     variation       1105
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77190657"
     variation       1107
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:574806150"
     variation       1117
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556282530"
     variation       1126
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183696297"
     variation       1133
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411260044"
     variation       1134
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193273301"
     variation       1137
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004853852"
     variation       1147
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425288977"
     variation       1148
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037459455"
     variation       1151
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3801329"
     variation       1154
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258886007"
     variation       1163
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024895453"
     variation       1166
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013459247"
     variation       1174
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364355596"
     variation       1177
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3801328"
     variation       1179
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368380123"
     variation       1183
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054907831"
     variation       1196
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352046290"
     variation       1201
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285757629"
     variation       1205
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1360612650"
     variation       1210
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225421414"
     variation       1211
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1290193057"
     variation       1212
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451492072"
     variation       1213
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239973336"
     variation       1216
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318989032"
     variation       1217
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567052802"
     variation       1218
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936437936"
     variation       1220
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476199580"
     variation       1225
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553859840"
     variation       1233
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389363369"
     variation       1239
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535193915"
     variation       1241
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568086456"
     variation       1253
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776514887"
     variation       1262
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404627992"
     variation       1271
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319079480"
     variation       1283
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1347025645"
     variation       1284
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428969645"
     variation       1290
                     /gene="LOC100130673"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1297102817"
     variation       1295
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1562728184"
     variation       1300
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772770818"
     variation       1301
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354734110"
     variation       1303
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313324597"
     variation       1306
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356269375"
     variation       1307
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:939057669"
     variation       1309
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206181267"
     variation       1316
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313483617"
     variation       1317
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922878690"
     variation       1325
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542376553"
     variation       1336
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206485145"
     variation       1340
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867270799"
     variation       1344
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913518577"
     variation       1351
                     /gene="LOC100130673"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:989619130"
     variation       1351
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:915431019"
     variation       1368
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1580020"
     variation       1370
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187437469"
     variation       1373
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570387809"
     variation       1377
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162061348"
     variation       1379
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399009099"
     variation       1382
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474627688"
     variation       1391
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982225126"
     variation       1398..1401
                     /gene="LOC100130673"
                     /replace="tgca"
                     /replace="tgcatgca"
                     /db_xref="dbSNP:1335165193"
     variation       1402
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454744382"
     variation       1403
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970413344"
     variation       1410
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922111911"
     variation       1413
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:963244006"
     variation       1423
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016066610"
     variation       1426
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1266897833"
     variation       1430
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262873554"
     variation       1431
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461509415"
     variation       1436
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205151862"
     variation       1439..1440
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1441628037"
     variation       1439
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:545903420"
     variation       1448
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974908598"
     variation       1454
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146599196"
     variation       1467
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:887217889"
     variation       1477
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016319519"
     variation       1480
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158557488"
     variation       1486
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:983492058"
     variation       1488
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182330040"
     variation       1492
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950688688"
     variation       1493
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560069461"
     variation       1501
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013905648"
     variation       1502..1505
                     /gene="LOC100130673"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1410110211"
     variation       1504
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174505789"
     variation       1508
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263963168"
     variation       1511
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402021198"
     variation       1520
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959297327"
     variation       1532
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244159447"
     variation       1537
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1033945858"
     variation       1538
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409702635"
     variation       1539
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000672467"
     variation       1544
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190006597"
     variation       1555
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323584719"
     variation       1558
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768222055"
     variation       1559
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1009215181"
     variation       1576
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:890771365"
     variation       1577
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050694212"
     variation       1578
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530129583"
     variation       1581
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482044092"
     variation       1584
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053980723"
     variation       1589
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922172784"
     variation       1590
                     /gene="LOC100130673"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935483119"
     variation       1592
                     /gene="LOC100130673"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1481454706"
     variation       1594
                     /gene="LOC100130673"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562910063"
     variation       1595..1598
                     /gene="LOC100130673"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:755465500"
ORIGIN      
gaggctggtttcttccaatatgtgttgcaaaatgttgaggtcattctgtttttgcttttctgggagtgcttttatctgtttgcctaagaaggagtccctcaaatgtgctgctttgtctgatgcctgtttcccaccttaataaactttctctgccttgttgctgtagtctctgtggcaagaagagaccctttctgataggagtcttggtagggaacagaacttgcccgcccccaacccagtcccattgcacaacaccgtgatgcttcctgtgtaacatggtctaccccctctctagcagcactagcacgagggcatgccctgtgaacctgaggctcttagtgcctgggccacacaagcacacaggtcaggcttttcctgccaatcataagggaaggagtgaccaaaataacatgtggggaagttacaatggtttgggaaacctcaaaaaattctaatggcagtgattttacagtctatgctaaatattaatgaattactttcttttaatgttgtagtccttttctttgctcacatggaaagagaaagaggtgaaacagcatgtagcatccaaaaataagaagatcttttccagagctgtgctccctgcccgcagccaggccccaacccacctctgcaacccctcctcctctcttccaatggcagtggcagtggcagctctttccttgctcctgacatcaccaccttgagcatcccctggctccaccaagctccagctatgtccaatatggtgctgcttggcagcagctcactgggacttgcccagaaagtggtgaaaaggtgggggttggagttgggcaaggtggtcactaagaagttcagcaatcaggaggttagcatagtgagtggtgaaagaatgagagaccaagctgcctatgtcattgtgaaaattaatgacaccttgacatctcttgctatgaccaatgtgtgcaaagccacatggtcctctggcatgaaggcagtactctcatgttctccatatgcccaacaagatcaaaaggacaagagtcatcctgcagtttctgcaaaacttgtagccaatgtgttttcagtagctgggttggagcatgtcagtactatggatctgcacactgctcaaatacagggattcttcagtactgctgtgaatgacttacatgtggagcctgcagttctgtgatggacctgagagaatattgcagactggaggaactgcagcattgtttcacccaaagcaggaggagccaaagagactccaccattcatggacagacctaacatggcttgccttgcaggagaagtgttggggtggataggatgtttctggttggtgatattaaagactgggtggctgtccttgtggatgacatacccaatgcatgtggcacaacacatgactctgcagacaagctactgtctgctggaaccactaaagtttataccacttcagctctgaggctgttattttacaaacaccagtccccaacaagacaacatgattttgctcttacttgtttagccatgttcctctatagctccatgtattggtctgttttcatgctgctaataaagacatacccgacactgggtaatttacaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]