GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:31:31, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_037863               1485 bp    RNA     linear   PRI 12-MAY-2018
DEFINITION  Homo sapiens long intergenic non-protein coding RNA 2495
            (LINC02495), long non-coding RNA.
ACCESSION   NR_037863 XR_108542 XR_112613 XR_113611
VERSION     NR_037863.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK091017.1 and AC113615.3.
            On or before Feb 16, 2011 this sequence version replaced
            XR_112613.1, XR_108542.1, XR_113611.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DA200618.1, SRR1803613.160271.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2145743
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-842               AK091017.1         1-842
            843-1485            AC113615.3         156824-157466
FEATURES             Location/Qualifiers
     source          1..1485
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4p16.1"
     gene            1..1485
                     /gene="LINC02495"
                     /note="long intergenic non-protein coding RNA 2495"
                     /db_xref="GeneID:285484"
                     /db_xref="HGNC:HGNC:27728"
     ncRNA           1..1485
                     /ncRNA_class="lncRNA"
                     /gene="LINC02495"
                     /product="long intergenic non-protein coding RNA 2495"
                     /db_xref="GeneID:285484"
                     /db_xref="HGNC:HGNC:27728"
     exon            1..207
                     /gene="LINC02495"
                     /inference="alignment:Splign:2.1.0"
     variation       9
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009935042"
     variation       11
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1223882158"
     variation       13
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343583216"
     variation       18
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056223509"
     variation       27
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207324920"
     variation       35
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268039469"
     variation       38
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234942962"
     variation       39
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540570422"
     variation       41
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:993192362"
     variation       43
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326960197"
     variation       44
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435077287"
     variation       46
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025958488"
     variation       50
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235996870"
     variation       51
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:560463469"
     variation       53
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424480746"
     variation       56
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1171101377"
     variation       57
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:867843433"
     variation       58
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:576960287"
     variation       59
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918955982"
     variation       60
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964327534"
     variation       63
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216335791"
     variation       64
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975612829"
     variation       66
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441396531"
     variation       67
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370198043"
     variation       70
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988151298"
     variation       71
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955466459"
     variation       72
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:912162967"
     variation       77
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943589265"
     variation       78
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469901739"
     variation       79
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562306217"
     variation       82
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988201029"
     variation       83
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338099232"
     variation       84
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913915512"
     variation       88
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357102821"
     variation       93
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926071548"
     variation       97
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372446588"
     variation       103
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332244122"
     variation       108
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053187169"
     variation       109
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531451021"
     variation       112
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226939904"
     variation       114
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168123348"
     variation       117
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014238621"
     variation       119
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1288315565"
     variation       120
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391771137"
     variation       125
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324865721"
     variation       140
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187104718"
     variation       145
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1472408941"
     variation       151
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926571698"
     variation       152
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937920785"
     variation       155
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211649587"
     variation       156
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056254274"
     variation       157
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896303290"
     variation       158
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273475450"
     variation       166
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:547948298"
     variation       170
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755069903"
     variation       172
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205413832"
     variation       177
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234799976"
     variation       178..182
                     /gene="LINC02495"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1560370169"
     variation       178
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1047438275"
     variation       185
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002045042"
     variation       186
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033478395"
     variation       191
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887454789"
     variation       195
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561174020"
     variation       197
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282898956"
     variation       199
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017265279"
     variation       205
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480701950"
     variation       206
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900112700"
     exon            208..285
                     /gene="LINC02495"
                     /inference="alignment:Splign:2.1.0"
     variation       219
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141665661"
     variation       224
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184410592"
     variation       225
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439374033"
     variation       249
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029122818"
     variation       251
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970388379"
     variation       252
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556686933"
     variation       258
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762339054"
     variation       259
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220238744"
     variation       262
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361324389"
     variation       267
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1315516671"
     variation       268..269
                     /gene="LINC02495"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1238945246"
     variation       269
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575835427"
     variation       270
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308436360"
     variation       272
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391476906"
     variation       273
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1484212229"
     variation       279
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:530819047"
     variation       280
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940320394"
     variation       284
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182572402"
     variation       285
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75157619"
     exon            286..408
                     /gene="LINC02495"
                     /inference="alignment:Splign:2.1.0"
     variation       288
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331359328"
     variation       289
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888418110"
     variation       290
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324647126"
     variation       305
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378657821"
     variation       307
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980698220"
     variation       312
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527889178"
     variation       314
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322572776"
     variation       318
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1457825383"
     variation       323
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:941978175"
     variation       327
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174143422"
     variation       330
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1037986304"
     variation       333
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478980568"
     variation       334
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547933544"
     variation       337
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960940754"
     variation       338
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187131212"
     variation       344
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277206083"
     variation       347
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007284911"
     variation       353
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260756641"
     variation       355
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202281863"
     variation       360
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312113861"
     variation       364
                     /gene="LINC02495"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1347793072"
     variation       364
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017288170"
     variation       366..370
                     /gene="LINC02495"
                     /replace="tgctg"
                     /replace="tgctgctg"
                     /db_xref="dbSNP:1227173197"
     variation       385
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199366136"
     variation       395
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1167654112"
     variation       401
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968749631"
     exon            409..1485
                     /gene="LINC02495"
                     /inference="alignment:Splign:2.1.0"
     variation       415
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866903042"
     variation       422
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456770709"
     variation       434
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187834894"
     variation       435
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115017327"
     variation       436
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414276685"
     variation       440
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193161728"
     variation       442
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:114139714"
     variation       444..450
                     /gene="LINC02495"
                     /replace="cag"
                     /replace="caggcag"
                     /db_xref="dbSNP:1331907216"
     variation       447
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007788636"
     variation       461
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018204742"
     variation       462
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866654619"
     variation       468
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968847078"
     variation       469
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197941055"
     variation       477
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456246942"
     variation       478
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259772710"
     variation       494
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:549872120"
     variation       497
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263373345"
     variation       503
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564682262"
     variation       506
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340560266"
     variation       509
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:892467551"
     variation       514
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010871399"
     variation       516
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281182858"
     variation       520
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326552824"
     variation       525
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022707155"
     variation       528..535
                     /gene="LINC02495"
                     /replace="ggc"
                     /replace="ggccaggc"
                     /db_xref="dbSNP:1333753164"
     variation       528
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969374220"
     variation       534
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410947270"
     variation       535
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227234167"
     variation       536
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981080165"
     variation       542
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956075246"
     variation       544
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535287290"
     variation       545
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555517672"
     variation       550
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572285375"
     variation       557
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182249572"
     variation       569
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450838014"
     variation       571
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918971453"
     variation       572
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930313200"
     variation       582
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356383072"
     variation       584
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255956800"
     variation       589
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1284661133"
     variation       591
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78030062"
     variation       592
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352146814"
     variation       594
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312173368"
     variation       598
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184683391"
     variation       599
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774829812"
     variation       605
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:942994781"
     variation       606
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039903033"
     variation       608
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1330887681"
     variation       610
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1321783731"
     variation       611
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759889001"
     variation       617
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177159878"
     variation       623
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:926471346"
     variation       626
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431759786"
     variation       630
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767214302"
     variation       633
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052477462"
     variation       637
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468386546"
     variation       638
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75150230"
     variation       640
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477553554"
     variation       643
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037492731"
     variation       648
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1011407937"
     variation       649
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043758317"
     variation       650
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905180514"
     variation       651
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755697296"
     variation       652
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577717859"
     variation       659
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330886551"
     variation       663
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488991856"
     variation       668
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002141361"
     variation       671
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224856386"
     variation       672
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1034912854"
     variation       681
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283310208"
     variation       685
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1235935011"
     variation       697
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325037673"
     variation       717
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543404054"
     variation       718
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563390630"
     variation       720
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74587364"
     variation       723
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745641765"
     variation       724
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1413821414"
     variation       726
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183230845"
     variation       727
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031766894"
     variation       731
                     /gene="LINC02495"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1250253800"
     variation       737
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1482992272"
     variation       742
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562295379"
     variation       743
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1271203718"
     variation       746
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026144586"
     variation       751
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528019459"
     variation       752
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1560383714"
     variation       755
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984933868"
     variation       756
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572821812"
     variation       765
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324725585"
     variation       767
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277766087"
     variation       773
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116409025"
     variation       774
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75681717"
     variation       777
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368669307"
     variation       778
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922821155"
     variation       781
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357348204"
     variation       783
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934234620"
     variation       792
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427767298"
     variation       794
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303650860"
     variation       796
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052589708"
     variation       799
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549735004"
     variation       800
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478585388"
     variation       802
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419834132"
     variation       803
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140691716"
     variation       804
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051511025"
     variation       810
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186002580"
     variation       827
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044173399"
     variation       832
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905212389"
     variation       845
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548947284"
     variation       846
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943047429"
     variation       858
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565865393"
     variation       859
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534473895"
     variation       863
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227755673"
     variation       870
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188639505"
     variation       875..876
                     /gene="LINC02495"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1341870218"
     variation       883
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192644705"
     variation       892
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453313574"
     variation       899
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376133476"
     variation       900
                     /gene="LINC02495"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1329006588"
     variation       901
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:896437757"
     variation       908
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:537067646"
     variation       919
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467047424"
     variation       920
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000365162"
     variation       925
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993412637"
     variation       927
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748390324"
     variation       936
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:951942965"
     variation       948
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184845267"
     variation       955..956
                     /gene="LINC02495"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1209256825"
     variation       955
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891933738"
     variation       960
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014783120"
     variation       963
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445737350"
     variation       967
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017731040"
     variation       980
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:964415563"
     variation       981
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430485442"
     variation       986
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145266511"
     variation       987
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542701328"
     variation       988
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448634692"
     variation       989..990
                     /gene="LINC02495"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:764256691"
     variation       990
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164194271"
     variation       992
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1294013844"
     variation       998
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:980089460"
     variation       1001
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552743683"
     variation       1002
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528378917"
     variation       1003
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019065221"
     variation       1005
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572608827"
     variation       1014
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373790244"
     variation       1017
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955647281"
     variation       1023
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1560383790"
     variation       1025
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541232085"
     variation       1026
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:988342058"
     variation       1033
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:914088399"
     variation       1035
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418626422"
     variation       1036
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770101568"
     variation       1037
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929138523"
     variation       1041
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564460269"
     variation       1043
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421211025"
     variation       1044
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777932127"
     variation       1045
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926667910"
     variation       1046
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487609898"
     variation       1048..1049
                     /gene="LINC02495"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1365011491"
     variation       1049
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038679018"
     variation       1054
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223299145"
     variation       1055
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938070085"
     variation       1067
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283710566"
     variation       1072
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241134309"
     variation       1074
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317796274"
     variation       1075
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:936268964"
     variation       1099
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300300350"
     variation       1103
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533422828"
     variation       1109
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1346991867"
     variation       1113
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763031792"
     variation       1119
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929220772"
     variation       1120
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6848954"
     variation       1130
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455783557"
     variation       1131
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1560383843"
     variation       1132
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:887619683"
     variation       1149
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346346568"
     variation       1151
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006431265"
     variation       1154
                     /gene="LINC02495"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1261339544"
     variation       1163
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137865449"
     variation       1165
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207129609"
     variation       1166
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:529415130"
     variation       1173
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464281221"
     variation       1176
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879379453"
     variation       1179
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774705698"
     variation       1185
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261098201"
     variation       1188
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046266520"
     variation       1189
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486153240"
     variation       1192
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415912099"
     variation       1193
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1029983662"
     variation       1197
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325430917"
     variation       1199
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368615168"
     variation       1205
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955679344"
     variation       1207
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363918746"
     variation       1216
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199787289"
     variation       1227
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6849178"
     variation       1230
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968252930"
     variation       1241
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386292279"
     variation       1254
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302790376"
     variation       1256
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468503963"
     variation       1258
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:13134639"
     variation       1261
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994781042"
     variation       1262
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142494029"
     variation       1265
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150530405"
     variation       1267
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138616042"
     variation       1273
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776769504"
     variation       1278
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228290505"
     variation       1279
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:867474781"
     variation       1286
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188391224"
     variation       1289
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557038748"
     variation       1296
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226586565"
     variation       1297
                     /gene="LINC02495"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:938101245"
     variation       1302
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1462451420"
     variation       1305
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992214534"
     variation       1308..1312
                     /gene="LINC02495"
                     /replace="gacga"
                     /replace="gacgacga"
                     /db_xref="dbSNP:751667535"
     variation       1310
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197819360"
     variation       1311
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917941705"
     variation       1320
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:911675777"
     variation       1322
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227448211"
     variation       1323
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191316812"
     variation       1324
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535832304"
     variation       1325
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964450509"
     variation       1326
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385675219"
     variation       1328
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974433996"
     variation       1329
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446588689"
     variation       1330
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239037208"
     variation       1331
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760338887"
     variation       1332
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047647395"
     variation       1334
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462529153"
     variation       1340..1351
                     /gene="LINC02495"
                     /replace="g"
                     /replace="gggccaagcgtg"
                     /db_xref="dbSNP:1367994423"
     variation       1340
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161808503"
     variation       1342
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446335285"
     variation       1343
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243741991"
     variation       1348
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887723964"
     variation       1349
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935649475"
     variation       1352
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941953542"
     variation       1353
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184947102"
     variation       1355
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251139553"
     variation       1356
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763628773"
     variation       1358
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572821357"
     variation       1362
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045901300"
     variation       1363
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753426081"
     variation       1364
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:900333294"
     variation       1370
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111445074"
     variation       1373
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392160834"
     variation       1374
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75050040"
     variation       1375
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12510751"
     variation       1378
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1560383980"
     variation       1382
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149295881"
     variation       1383
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866462033"
     variation       1391
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375585762"
     variation       1400
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357850999"
     variation       1401
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021284197"
     variation       1405
                     /gene="LINC02495"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447741313"
     variation       1406
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189412028"
     variation       1410
                     /gene="LINC02495"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266404848"
     variation       1411
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144527748"
     variation       1416
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950667673"
     variation       1420
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009207839"
     variation       1441
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240095708"
     variation       1444
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349224749"
     variation       1445
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281609101"
     variation       1447
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568892005"
     variation       1454
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408111009"
     variation       1455
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542624320"
     variation       1464
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:559821822"
     variation       1466
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115568126"
     variation       1467
                     /gene="LINC02495"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780031111"
     variation       1476
                     /gene="LINC02495"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974487927"
     variation       1478
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398856341"
     variation       1480
                     /gene="LINC02495"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925701795"
ORIGIN      
gagctgccggagcgtgcgcactgggccagcgggcggccggggcagggctggggtcccggcgctgagcgcccccagccgcgccgggcagcctggcgcctcgctgagtcggagcaacccccggcaggagctttcaggctctggtcaagcctcgggacccgggaagctatccctgccctcgggggctcgagcctggagtggggcttgcagaaaaggaaagggggctggcctaaaggcaagaagagaaaccccccgagggaccttgctgttccgtgttcctacgacagggtacatgatattcctgaatgagcagagaagtcagctgagggccacacaccccgatctgcctttcacagaaatcatgaagatgctggctgttcagtgggcccagctgtctcaggataaaaagggggagatgaactcaatgacctctactgcgggacctccaggcagctcttcagctccctgtgcaacaagaaggaacctgctgcaaaggcagcacctgcagcgcctctcaggtaaccagcctgggccaggcggctcagccgcaaacgctggccttgactccacctgcgccagaggtcaccaacaggcggcccacgtgacacctcttgttattaaaatgcaattttaagacagactctagtcaagcccacttaccaccaggtgggtgtttaggacagggtaggtcttccactatatctgttttcctcttagttcgccaggcccgcctgctctgggccacgcaggacacggacgtcagcttctcctggagcgctcgctcactttattccatctctacgagctcctcaagtatcccagagcatccccaggcctgtggccacctcgggtctggatgccgcattctctgacctgtggcacattctgggtgcccatgattatgatgaggttctgtgcccatgtggcctcagggctcttgagaccacccttcaaccaggtctttgctcacctgtctcctgcccagggacgccacccaggtcaccggtgcaaacctccagcccctgcccgtttctctccatgagtgcattgccacctcgcagcctcttccacttgctcattcctggtgttattgcctgtctcccactggaagagaaggccctcaagttcagcaactgttttgcctgttttgttcactgtggtgaaccccgggcctagaaccacgcctggcactcccagtaggtgctcaataagtatccaatgagtggacaaatgaatggatgtgttcaacaaatgaccctagagcgtgtattccttccagggacagagcgaggtactggggacacaggaaggacgaggcagagctccgcgctgacgaaaccaagggccaagcgtgcgagtgaatacgaacatcctggcgttaaaacgtcttgcattctagtgaaatgagacccattggacacagagaagccccaccacaattgcatctgtgtaaaatcgagagaaagatcgtgaaaacagccatggcag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]