LOCUS       NR_037465                 65 bp    RNA     linear   PRI 04-SEP-2020
DEFINITION  Homo sapiens microRNA 3714 (MIR3714), microRNA.
ACCESSION   NR_037465
VERSION     NR_037465.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 65)
  AUTHORS   Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi
            S, Kawano M, Matsushita S, Ochiya T and Miyajima A.
  TITLE     Identification of the novel 3' UTR sequences of human IL-21 mRNA as
            potential targets of miRNAs
  JOURNAL   Sci Rep 7 (1), 7780 (2017)
   PUBMED   28798470
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 65)
  AUTHORS   Schulte JH, Marschall T, Martin M, Rosenstiel P, Mestdagh P,
            Schlierf S, Thor T, Vandesompele J, Eggert A, Schreiber S, Rahmann
            S and Schramm A.
  TITLE     Deep sequencing reveals differential expression of microRNAs in
            favorable versus unfavorable neuroblastoma
  JOURNAL   Nucleic Acids Res. 38 (17), 5919-5928 (2010)
   PUBMED   20466808
REFERENCE   3  (bases 1 to 65)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC090943.3.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-65                AC090943.3         41682-41746         c
FEATURES             Location/Qualifiers
     source          1..65
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p24.3"
     gene            1..65
                     /gene="MIR3714"
                     /note="microRNA 3714"
                     /db_xref="GeneID:100500913"
                     /db_xref="HGNC:HGNC:38928"
                     /db_xref="miRBase:MI0016135"
     precursor_RNA   1..65
                     /gene="MIR3714"
                     /product="microRNA 3714"
                     /db_xref="GeneID:100500913"
                     /db_xref="HGNC:HGNC:38928"
                     /db_xref="miRBase:MI0016135"
     exon            1..65
                     /gene="MIR3714"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           1..22
                     /ncRNA_class="miRNA"
                     /gene="MIR3714"
                     /product="hsa-miR-3714"
                     /db_xref="miRBase:MIMAT0018165"
                     /db_xref="GeneID:100500913"
                     /db_xref="HGNC:HGNC:38928"
                     /db_xref="miRBase:MI0016135"
     variation       5..11
                     /gene="MIR3714"
                     /replace="gcag"
                     /replace="gcagcag"
                     /db_xref="dbSNP:897080435"
     variation       5
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041972338"
     variation       6
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760552376"
     variation       9
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904545731"
     variation       11
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1697450176"
     variation       15
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372877817"
     variation       16
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284593360"
     variation       17
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1697450404"
     variation       21
                     /gene="MIR3714"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2546660470"
     variation       23
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1697450478"
     variation       25
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358667102"
     variation       26
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1697450646"
     variation       29
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935974159"
     variation       31
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404508225"
     variation       32
                     /gene="MIR3714"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:537488110"
     variation       33
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1697450984"
     variation       38
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:55835744"
     variation       39
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372887672"
     variation       40
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024426159"
     variation       43
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574434395"
     variation       44
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906866849"
     variation       45
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1697451837"
     variation       46
                     /gene="MIR3714"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414156596"
     variation       50
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1697451993"
     variation       52
                     /gene="MIR3714"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241801698"
     variation       53
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1697452209"
     variation       54
                     /gene="MIR3714"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543336822"
     variation       55
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322195127"
     variation       58
                     /gene="MIR3714"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1697452568"
     variation       59
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024568432"
     variation       60
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2124944218"
     variation       62
                     /gene="MIR3714"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034072337"
ORIGIN      

gaaggcagcagtgctcccctgtgacgtgctccatcaccgggcagggaagacaccgctgccacctc

//