2024-04-25 21:19:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_037230 89 bp RNA linear ROD 26-OCT-2020 DEFINITION Mus musculus microRNA 3070a (Mir3070a), microRNA. ACCESSION NR_037230 VERSION NR_037230.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 89) AUTHORS Kozomara A and Griffiths-Jones S. TITLE miRBase: integrating microRNA annotation and deep-sequencing data JOURNAL Nucleic Acids Res 39 (Database issue), D152-D157 (2011) PUBMED 21037258 REFERENCE 2 (bases 1 to 89) AUTHORS Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C and Bartel DP. TITLE Mammalian microRNAs: experimental evaluation of novel and previously annotated genes JOURNAL Genes Dev 24 (10), 992-1009 (2010) PUBMED 20413612 REFERENCE 3 (bases 1 to 89) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC152063.5. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM610880.1, SRR1660821.90387.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-89 AC152063.5 101504-101592 c FEATURES Location/Qualifiers source 1..89 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="12" /map="12 60.37 cM" gene 1..89 /gene="Mir3070a" /gene_synonym="mir-3070-1; mmu-mir-3070-1; mmu-mir-3070a" /note="microRNA 3070a" /db_xref="GeneID:100526472" /db_xref="MGI:MGI:4834243" /db_xref="miRBase:MI0014032" precursor_RNA 1..89 /gene="Mir3070a" /gene_synonym="mir-3070-1; mmu-mir-3070-1; mmu-mir-3070a" /product="microRNA 3070a" /db_xref="GeneID:100526472" /db_xref="MGI:MGI:4834243" /db_xref="miRBase:MI0014032" exon 1..89 /gene="Mir3070a" /gene_synonym="mir-3070-1; mmu-mir-3070-1; mmu-mir-3070a" /inference="alignment:Splign:2.1.0" ncRNA 17..39 /ncRNA_class="miRNA" /gene="Mir3070a" /gene_synonym="mir-3070-1; mmu-mir-3070-1; mmu-mir-3070a" /product="mmu-miR-3070-5p" /db_xref="miRBase:MIMAT0014846" /db_xref="GeneID:100526472" /db_xref="MGI:MGI:4834243" /db_xref="miRBase:MI0014032" ncRNA 57..78 /ncRNA_class="miRNA" /gene="Mir3070a" /gene_synonym="mir-3070-1; mmu-mir-3070-1; mmu-mir-3070a" /product="mmu-miR-3070-3p" /db_xref="miRBase:MIMAT0014847" /db_xref="GeneID:100526472" /db_xref="MGI:MGI:4834243" /db_xref="miRBase:MI0014032" ORIGIN
gtgctgagtgaggctgagcccctgaccttgaacctgggatcctatccatgatctcctggtgctaccgtcaggggtagattccttgtcat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]