GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:26:58, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NR_036484               2653 bp    RNA     linear   PRI 21-AUG-2020
DEFINITION  Homo sapiens FEZF1 antisense RNA 1 (FEZF1-AS1), long non-coding
            RNA.
ACCESSION   NR_036484 XM_001721424 XM_001721629 XM_001726051 XM_001726316
VERSION     NR_036484.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2653)
  AUTHORS   Zhou Y, Xu S, Xia H, Gao Z, Huang R, Tang E and Jiang X.
  TITLE     Long noncoding RNA FEZF1-AS1 in human cancers
  JOURNAL   Clin. Chim. Acta 497, 20-26 (2019)
   PUBMED   31276636
  REMARK    GeneRIF: role of FEZF1-AS1 in carcinogenesis and progression
            suggests that it may be a potential diagnostic biomarker or a novel
            therapeutic target for cancers
            Review article
REFERENCE   2  (bases 1 to 2653)
  AUTHORS   Shi C, Sun L and Song Y.
  TITLE     FEZF1-AS1: a novel vital oncogenic lncRNA in multiple human
            malignancies
  JOURNAL   Biosci. Rep. 39 (6) (2019)
   PUBMED   31175144
  REMARK    GeneRIF: FEZF1-AS1: a novel vital oncogenic lncRNA in multiple
            human malignancies.
            Review article
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2653)
  AUTHORS   Zhang Y, Yang QX, Peng TT, Wang LJ, Xiao GL and Tang SB.
  TITLE     Prognostic value of lncRNA FEZF1 antisense RNA 1 over-expression in
            oncologic outcomes of patients with solid tumors
  JOURNAL   Medicine (Baltimore) 98 (24), e15982 (2019)
   PUBMED   31192939
  REMARK    GeneRIF: Study shows that increased lncRNA FEZF1- AS1 expression is
            significantly associated with unfavorable clinical outcomes in
            patients with solid tumors. As a vital node in the gene expression
            pathway, lncRNA FEZF1-AS1 is regulated by upstream molecules and
            regulating the occurrence and progression of cancer cells in
            multiple ways. [meta-analysis]
REFERENCE   4  (bases 1 to 2653)
  AUTHORS   Quan LJ and Wang WJ.
  TITLE     FEZF1-AS1 functions as an oncogenic lncRNA in retinoblastoma
  JOURNAL   Biosci. Rep. 39 (5) (2019)
   PUBMED   31076545
  REMARK    GeneRIF: Loss-of-function study indicated silencing FEZF1-AS1
            expression inhibited retinoblastoma cell proliferation, invasion
            and migration. In conclusion, FEZF1-AS1 functions as an oncogenic
            lncRNA in retinoblastoma.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2653)
  AUTHORS   Gong J, Wang J, Liu T, Hu J and Zheng J.
  TITLE     lncRNA FEZF1AS1 contributes to cell proliferation, migration and
            invasion by sponging miR4443 in hepatocellular carcinoma
  JOURNAL   Mol Med Rep 18 (6), 5614-5620 (2018)
   PUBMED   30365146
  REMARK    GeneRIF: the results of the present study demonstrated that
            FEZF1-AS1 promoted the proliferation, migration and invasion of HCC
            cells by regulating miR-4443 expression levels. The present results
            highlight the importance of the FEZF1-AS1/miR-4443 axis during HCC
            development and progression.
REFERENCE   6  (bases 1 to 2653)
  AUTHORS   Zhang Z, Sun L, Zhang Y, Lu G, Li Y and Wei Z.
  TITLE     Long non-coding RNA FEZF1-AS1 promotes breast cancer stemness and
            tumorigenesis via targeting miR-30a/Nanog axis
  JOURNAL   J. Cell. Physiol. 233 (11), 8630-8638 (2018)
   PUBMED   29797562
  REMARK    GeneRIF: our study validate the important role of
            FEZF1-AS1/miR-30a/Nanog in breast cancer stemness and
            tumorigenesis, providing a novel insight and treatment strategy for
            breast cancer.
REFERENCE   7  (bases 1 to 2653)
  AUTHORS   Gong W, Cao Y, Wang Y, Yang L, Su W, Qiu F, Datta S, Rao B, Xian J,
            Lin M, Feng Y, Zhang X, Zhou Y, Gao X and Lu J.
  TITLE     Upregulation of LncRNA FEZF-AS1 is associated with advanced
            clinical stages and family history of cancer in patients with NSCLC
  JOURNAL   Pathol. Res. Pract. 214 (6), 857-861 (2018)
   PUBMED   29709443
  REMARK    GeneRIF: These results suggest that lncRNA FEZF-AS1 relate to the
            progression of lung cancer patients
REFERENCE   8  (bases 1 to 2653)
  AUTHORS   He R, Zhang FH and Shen N.
  TITLE     LncRNA FEZF1-AS1 enhances epithelial-mesenchymal transition (EMT)
            through suppressing E-cadherin and regulating WNT pathway in
            non-small cell lung cancer (NSCLC)
  JOURNAL   Biomed. Pharmacother. 95, 331-338 (2017)
   PUBMED   28858731
REFERENCE   9  (bases 1 to 2653)
  AUTHORS   Liu YW, Xia R, Lu K, Xie M, Yang F, Sun M, De W, Wang C and Ji G.
  TITLE     LincRNAFEZF1-AS1 represses p21 expression to promote gastric cancer
            proliferation through LSD1-Mediated H3K4me2 demethylation
  JOURNAL   Mol. Cancer 16 (1), 39 (2017)
   PUBMED   28209170
  REMARK    GeneRIF: Results provide evidence that FEZF1-AS1 is overexpressed
            in gastric cancer tissues; its overexpression may predict poor
            prognosis. FEZF1-AS1 promoted gastric cancer cell proliferation and
            tumorigenesis by affecting cell cycle progression partly through
            suppressing P21 expression.
            Publication Status: Online-Only
REFERENCE   10 (bases 1 to 2653)
  AUTHORS   Chen N, Guo D, Xu Q, Yang M, Wang D, Peng M, Ding Y, Wang S and
            Zhou J.
  TITLE     Long non-coding RNA FEZF1-AS1 facilitates cell proliferation and
            migration in colorectal carcinoma
  JOURNAL   Oncotarget 7 (10), 11271-11283 (2016)
   PUBMED   26848625
  REMARK    GeneRIF: Findings indicate that the dysregulation of FEZF1-AS1
            participates in colorectal tumorigenesis and progression, which
            might be achieved, at least in part, through FEZF1 induction.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK057037.1 and AC015983.7.
            On or before Aug 7, 2010 this sequence version replaced
            XM_001721424.1, XM_001726316.1, XM_001726051.1, XM_001721629.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK057037.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA2144333, SAMEA2148093
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-968               AK057037.1         1-968
            969-1626            AC015983.7         141818-142475
            1627-1901           AK057037.1         1615-1889
            1902-1902           AC015983.7         143004-143004
            1903-2653           AK057037.1         1891-2641
FEATURES             Location/Qualifiers
     source          1..2653
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q31.32"
     gene            1..2653
                     /gene="FEZF1-AS1"
                     /note="FEZF1 antisense RNA 1"
                     /db_xref="GeneID:154860"
                     /db_xref="HGNC:HGNC:41001"
     ncRNA           1..2653
                     /ncRNA_class="lncRNA"
                     /gene="FEZF1-AS1"
                     /product="FEZF1 antisense RNA 1"
                     /db_xref="GeneID:154860"
                     /db_xref="HGNC:HGNC:41001"
     exon            1..611
                     /gene="FEZF1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369460018"
     variation       10
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208653164"
     variation       13
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288035013"
     variation       17
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769912076"
     variation       19
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205726528"
     variation       22
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775569945"
     variation       25
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762902892"
     variation       26
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559647292"
     variation       29
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527670913"
     variation       30
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762299246"
     variation       33
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541060829"
     variation       37
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922828804"
     variation       44
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989927049"
     variation       46
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756663519"
     variation       48
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1584960428"
     variation       55
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373878310"
     variation       56
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564218713"
     variation       57
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1328009890"
     variation       58
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987103414"
     variation       59
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1454327695"
     variation       60
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752279353"
     variation       61
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757779477"
     variation       68
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777493862"
     variation       74
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563042526"
     variation       79
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746627634"
     variation       81
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757141447"
     variation       82
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422177561"
     variation       83
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215380669"
     variation       85
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257598293"
     variation       90
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456719225"
     variation       93
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780945004"
     variation       94
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533225178"
     variation       97
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769754771"
     variation       99
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775340667"
     variation       100
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184831141"
     variation       104
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749403794"
     variation       105
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768608381"
     variation       110
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543424270"
     variation       117
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255164547"
     variation       118
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482131346"
     variation       120
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179197849"
     variation       121
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166977654"
     variation       123
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774703337"
     variation       125
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550264578"
     variation       128..130
                     /gene="FEZF1-AS1"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:587777740"
     variation       131
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176827885"
     variation       134
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768039426"
     variation       135
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570106853"
     variation       139
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761076480"
     variation       141
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766998064"
     variation       146
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431485250"
     variation       147
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277834758"
     variation       152
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77195921"
     variation       154
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316238912"
     variation       156
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225787888"
     variation       157
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439173093"
     variation       159
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754240132"
     variation       161
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176854912"
     variation       163
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345006402"
     variation       166
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757983995"
     variation       168
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763505250"
     variation       171
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563042673"
     variation       172
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1247719840"
     variation       173
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362697571"
     variation       179
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751275983"
     variation       183
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756926183"
     variation       184
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780783637"
     variation       185
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74961049"
     variation       191
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938528614"
     variation       194
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780100491"
     variation       199
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428335007"
     variation       206
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563042717"
     variation       207..210
                     /gene="FEZF1-AS1"
                     /replace="ggtg"
                     /replace="ggtggtg"
                     /db_xref="dbSNP:781242932"
     variation       209
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456415696"
     variation       210
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584960734"
     variation       217
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1349403934"
     variation       218
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464536234"
     variation       220
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749180825"
     variation       221
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768824348"
     variation       223
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426772644"
     variation       228
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370467502"
     variation       229
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054042595"
     variation       230
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538115706"
     variation       231..236
                     /gene="FEZF1-AS1"
                     /replace="agg"
                     /replace="aggagg"
                     /db_xref="dbSNP:750619742"
     variation       233
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772451169"
     variation       237
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773497993"
     variation       238
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284392993"
     variation       240
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761133760"
     variation       243
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1231438925"
     variation       244
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1264408771"
     variation       246
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263051831"
     variation       253
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351966838"
     variation       255
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893670572"
     variation       256
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771407843"
     variation       258
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570196942"
     variation       259
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490758371"
     variation       263
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222758396"
     variation       265
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759927643"
     variation       266
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:534580940"
     variation       268
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751063817"
     variation       269
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1584960826"
     variation       271
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224150499"
     variation       275
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1045001044"
     variation       276
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1469535868"
     variation       278
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761248281"
     variation       280
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750065914"
     variation       281
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426564275"
     variation       286
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371371960"
     variation       287
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755972168"
     variation       289
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779686674"
     variation       295
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753860361"
     variation       296
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309578849"
     variation       299
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754892083"
     variation       301
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1048562563"
     variation       306
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025604327"
     variation       308
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778866185"
     variation       310
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867706113"
     variation       311
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748239139"
     variation       315
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772221066"
     variation       316
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778198481"
     variation       318
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747228982"
     variation       319
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457307345"
     variation       326
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584960926"
     variation       327
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219773170"
     variation       331
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1174503070"
     variation       332
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771460949"
     variation       334
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776884375"
     variation       335
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584960949"
     variation       337
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759906335"
     variation       341
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866141957"
     variation       343
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374950795"
     variation       346
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456556147"
     variation       350
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557760939"
     variation       354
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571282420"
     variation       356
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397643377"
     variation       360
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481455715"
     variation       361
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254010936"
     variation       364
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761375065"
     variation       367
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767014192"
     variation       371
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1005604468"
     variation       373
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246136077"
     variation       376
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778010186"
     variation       378
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285163919"
     variation       379
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319621421"
     variation       383
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1584961035"
     variation       384
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760302021"
     variation       386
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251469294"
     variation       390
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766004411"
     variation       393
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1196485431"
     variation       398
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244917519"
     variation       402
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457476403"
     variation       404
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461697009"
     variation       405
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182562293"
     variation       406
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255557987"
     variation       408
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196880268"
     variation       411
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:537105864"
     variation       412
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328359140"
     variation       413
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172830506"
     variation       416
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757486716"
     variation       417..419
                     /gene="FEZF1-AS1"
                     /replace="tga"
                     /replace="tgatga"
                     /db_xref="dbSNP:756314733"
     variation       427
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465450118"
     variation       429
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754731624"
     variation       430
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408989066"
     variation       433
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563043057"
     variation       439
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449386379"
     variation       440
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398984263"
     variation       441
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301812506"
     variation       442
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778726502"
     variation       444
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383346615"
     variation       447
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295888203"
     variation       449
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901307068"
     variation       453
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179241486"
     variation       456
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557022623"
     variation       457
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264739979"
     variation       458
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324276887"
     variation       459
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1471303842"
     variation       460
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752666922"
     variation       461
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254115585"
     variation       462
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482322585"
     variation       467
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955570570"
     variation       469
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264225576"
     variation       470
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477599040"
     variation       473..476
                     /gene="FEZF1-AS1"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1192031321"
     variation       473
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987562788"
     variation       476
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182014767"
     variation       481
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759624597"
     variation       485
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923603323"
     variation       488
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000106128"
     variation       490
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758618132"
     variation       494
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777966600"
     variation       496
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151311760"
     variation       497
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298251750"
     variation       501
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757453707"
     variation       503
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397744626"
     variation       504
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781410210"
     variation       505
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746231446"
     variation       507
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206746982"
     variation       508
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218362779"
     variation       509
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770182694"
     variation       513
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318627911"
     variation       514
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:796143920"
     variation       515
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218083905"
     variation       518
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893917390"
     variation       519
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488118034"
     variation       520
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776047876"
     variation       522
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140478550"
     variation       527
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:914972337"
     variation       528
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145467198"
     variation       529
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044842458"
     variation       530
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969381431"
     variation       534
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407342085"
     variation       538
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772727758"
     variation       540
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:979962300"
     variation       541
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359336816"
     variation       542
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529016167"
     variation       544
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760136356"
     variation       545
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765948560"
     variation       546
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350074050"
     variation       549
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:906461526"
     variation       550
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384954808"
     variation       553
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776285722"
     variation       556
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291537900"
     variation       557
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584961402"
     variation       559
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375523895"
     variation       561
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147660574"
     variation       562
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765075612"
     variation       563
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047517801"
     variation       565
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1454935745"
     variation       567
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374502418"
     variation       568
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142331989"
     variation       571
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238001752"
     variation       574
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1563043382"
     variation       584
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758386407"
     variation       585
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186438185"
     variation       588
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572828311"
     variation       593
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221347151"
     variation       594
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245342820"
     variation       595
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751696310"
     variation       597
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757305012"
     variation       599
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:973010512"
     variation       601
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781329012"
     variation       605
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284920785"
     variation       609
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746102840"
     variation       611
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205768283"
     exon            612..782
                     /gene="FEZF1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       616
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929891763"
     variation       621
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246019595"
     variation       622
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038739863"
     variation       623
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195560534"
     variation       629
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405199392"
     variation       631
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584961901"
     variation       634
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253933362"
     variation       646
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983837897"
     variation       650
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899938270"
     variation       652
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157008164"
     variation       658
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996907894"
     variation       664
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1410633593"
     variation       669
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051168637"
     variation       672
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401594698"
     variation       688
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207040011"
     variation       689
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1164729007"
     variation       691
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891325403"
     variation       694
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204871598"
     variation       696
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:976450567"
     variation       700
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922867183"
     variation       704
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999427085"
     variation       718
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438141548"
     variation       720
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768657768"
     variation       729
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1563043803"
     variation       730
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935606228"
     variation       735
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957821226"
     variation       737
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222777309"
     variation       739
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584961959"
     variation       743
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1373572814"
     variation       744
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566267725"
     variation       749
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052724147"
     variation       760
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021891244"
     variation       770
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915368519"
     variation       774..779
                     /gene="FEZF1-AS1"
                     /replace="gag"
                     /replace="gaggag"
                     /db_xref="dbSNP:1200848553"
     variation       777
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337244482"
     variation       782
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969122346"
     exon            783..1757
                     /gene="FEZF1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       785
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992611900"
     variation       787
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912649376"
     variation       790
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934717224"
     variation       795
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339730064"
     variation       797..799
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="cgc"
                     /db_xref="dbSNP:1266992452"
     variation       797
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222036202"
     variation       803
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584962370"
     variation       806
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490600095"
     variation       808
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292461582"
     variation       812
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225409352"
     variation       813
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194475724"
     variation       818
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1339274960"
     variation       820
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558429432"
     variation       822
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1219889163"
     variation       826
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893322003"
     variation       832
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577609706"
     variation       847
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340089962"
     variation       856
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218888127"
     variation       857
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1326573644"
     variation       858
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543836944"
     variation       864
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1584962404"
     variation       865..866
                     /gene="FEZF1-AS1"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1486881194"
     variation       868
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765893166"
     variation       871
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172773229"
     variation       872
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563613169"
     variation       874
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906114362"
     variation       882
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584962419"
     variation       883
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212021011"
     variation       885
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427308804"
     variation       886
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:941236111"
     variation       887
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001830894"
     variation       898
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:571826168"
     variation       901
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1248720909"
     variation       902
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263177469"
     variation       903
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487593392"
     variation       910
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584962441"
     variation       916..920
                     /gene="FEZF1-AS1"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1274239492"
     variation       919
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201088566"
     variation       920
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034626628"
     variation       924
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261963992"
     variation       939
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223638254"
     variation       943
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899636166"
     variation       946..950
                     /gene="FEZF1-AS1"
                     /replace="gc"
                     /replace="gcggc"
                     /db_xref="dbSNP:1441162550"
     variation       949
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574052478"
     variation       951
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896252018"
     variation       957
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333223518"
     variation       960
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998033928"
     variation       961
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405308635"
     variation       962
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1004400170"
     variation       963
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392841247"
     variation       968
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427476965"
     variation       971
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751010392"
     variation       982
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157049951"
     variation       993
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:962904047"
     variation       995
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239157191"
     variation       1008
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180972033"
     variation       1012
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542773174"
     variation       1027
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1009627918"
     variation       1030
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210151585"
     variation       1034
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:559948622"
     variation       1039
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528702079"
     variation       1042
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1021935633"
     variation       1046
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1028252510"
     variation       1047
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281622856"
     variation       1050
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:953904641"
     variation       1051
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986816623"
     variation       1057
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320152067"
     variation       1061
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912524554"
     variation       1062
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111307142"
     variation       1066
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435809187"
     variation       1068..1080
                     /gene="FEZF1-AS1"
                     /replace="cgcgc"
                     /replace="cgcgcgcgc"
                     /replace="cgcgcgcgcgc"
                     /replace="cgcgcgcgcgcgc"
                     /replace="cgcgcgcgcgcgcgc"
                     /replace="cgcgcgcgcgcgcgcgc"
                     /replace="cgcgcgcgcgcgcgcgcgc"
                     /db_xref="dbSNP:rs143482521"
     variation       1068
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989324403"
     variation       1073
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764657506"
     variation       1078
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1381196370"
     variation       1081
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565618426"
     variation       1082
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1443193893"
     variation       1083
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1385115962"
     variation       1086
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182957272"
     variation       1089
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483915198"
     variation       1096
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1239851579"
     variation       1097
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530411273"
     variation       1099
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350312749"
     variation       1102
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235565403"
     variation       1104
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243443762"
     variation       1107
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947588922"
     variation       1112
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285762620"
     variation       1113
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1313267348"
     variation       1114
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229946662"
     variation       1128
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348910837"
     variation       1132
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207431534"
     variation       1133
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146187497"
     variation       1138
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73717636"
     variation       1139
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430165535"
     variation       1141
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985299400"
     variation       1142
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300317710"
     variation       1149
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757618202"
     variation       1151
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765415262"
     variation       1160
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166005067"
     variation       1172
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447113471"
     variation       1181
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426075655"
     variation       1184
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1057369750"
     variation       1185
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750708020"
     variation       1187
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536310234"
     variation       1193
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866357339"
     variation       1199
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758646890"
     variation       1203
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943360716"
     variation       1215
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039605113"
     variation       1217
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264797004"
     variation       1219
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1037223337"
     variation       1220
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370929828"
     variation       1221
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898210930"
     variation       1224
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192438731"
     variation       1226
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546298300"
     variation       1233
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1265805773"
     variation       1244
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223545888"
     variation       1246
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995342718"
     variation       1260
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899791399"
     variation       1262
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149491567"
     variation       1264
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280277671"
     variation       1265
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403325470"
     variation       1266
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365262630"
     variation       1269
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757892264"
     variation       1279
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538489793"
     variation       1280
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353222605"
     variation       1286
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019508334"
     variation       1287
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956272957"
     variation       1298
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747018841"
     variation       1299
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425131275"
     variation       1300
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528499281"
     variation       1310
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1479888073"
     variation       1319
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451311337"
     variation       1320
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:569164236"
     variation       1321
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1584962708"
     variation       1323
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143944199"
     variation       1324
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250626565"
     variation       1331
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557290917"
     variation       1332
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191228684"
     variation       1336
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260075590"
     variation       1339
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903490063"
     variation       1347
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330689082"
     variation       1349
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:553006624"
     variation       1351
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331163531"
     variation       1353
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781180006"
     variation       1354
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:573962375"
     variation       1357
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448161544"
     variation       1360
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584962741"
     variation       1369
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584962743"
     variation       1370
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556475110"
     variation       1371
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468854041"
     variation       1372..1377
                     /gene="FEZF1-AS1"
                     /replace="ccccc"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1177828843"
     variation       1372
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417030217"
     variation       1373
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563044304"
     variation       1376
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:553554845"
     variation       1377
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:961016902"
     variation       1379
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1459028299"
     variation       1381
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241257336"
     variation       1382
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992718849"
     variation       1384
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344442345"
     variation       1385
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1057515085"
     variation       1386
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584962777"
     variation       1388
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441937998"
     variation       1392
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950961952"
     variation       1394
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315397839"
     variation       1399..1400
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1308733950"
     variation       1400
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241402696"
     variation       1402
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584962799"
     variation       1404
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984860742"
     variation       1406
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335322519"
     variation       1409
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394904710"
     variation       1411
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402323671"
     variation       1414
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908112033"
     variation       1417..1418
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1334383125"
     variation       1419
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909301193"
     variation       1423
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451133943"
     variation       1428
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261872106"
     variation       1431
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159006530"
     variation       1435
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441323270"
     variation       1438
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573466532"
     variation       1439
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036662111"
     variation       1443
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747946031"
     variation       1446
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995226497"
     variation       1452
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572242730"
     variation       1459
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:921162480"
     variation       1462..1469
                     /gene="FEZF1-AS1"
                     /replace="ct"
                     /replace="ctacggct"
                     /db_xref="dbSNP:1469372197"
     variation       1462
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933898493"
     variation       1465
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148674669"
     variation       1471
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356330490"
     variation       1473
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1049491605"
     variation       1474
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889647065"
     variation       1476
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341630483"
     variation       1479
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:945205607"
     variation       1481..1484
                     /gene="FEZF1-AS1"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1380081326"
     variation       1482
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1008058640"
     variation       1485
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043452761"
     variation       1488
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1183709432"
     variation       1492
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375767867"
     variation       1496
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1363463685"
     variation       1497
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162477392"
     variation       1501
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:903645468"
     variation       1503
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370182583"
     variation       1504
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189642077"
     variation       1505
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426816499"
     variation       1506
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262693514"
     variation       1507
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955946082"
     variation       1509
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489420761"
     variation       1510
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769603293"
     variation       1512
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1162635642"
     variation       1522
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584962935"
     variation       1523
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58938116"
     variation       1525
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968678700"
     variation       1534
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:866821679"
     variation       1538
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357649735"
     variation       1544
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554418094"
     variation       1545
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461991472"
     variation       1547
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224566817"
     variation       1548
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117177688"
     variation       1550
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278336955"
     variation       1551
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394571820"
     variation       1555
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584962970"
     variation       1557
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142164322"
     variation       1558
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1322638639"
     variation       1560
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1584962983"
     variation       1562
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960231871"
     variation       1566
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992977548"
     variation       1567
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529660556"
     variation       1569
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1026990949"
     variation       1570
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308152824"
     variation       1572
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546283810"
     variation       1573
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566268250"
     variation       1579
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1464084047"
     variation       1579
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950876995"
     variation       1586
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194524957"
     variation       1592
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232012239"
     variation       1597
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478921590"
     variation       1599
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="cgcc"
                     /db_xref="dbSNP:1245257990"
     variation       1601
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768357850"
     variation       1602..1605
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="ggcg"
                     /db_xref="dbSNP:1198525407"
     variation       1602..1603
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="ctgca"
                     /db_xref="dbSNP:1292590966"
     variation       1602
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006435910"
     variation       1603
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194565767"
     variation       1604
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317882463"
     variation       1606..1607
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="ctagct"
                     /db_xref="dbSNP:1220003514"
     variation       1606
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320904586"
     variation       1611
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940930610"
     variation       1613..1626
                     /gene="FEZF1-AS1"
                     /replace="ag"
                     /replace="agggctgcacagag"
                     /db_xref="dbSNP:113818592"
     variation       1628
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016351204"
     variation       1629
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6976916"
     variation       1631
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445913795"
     variation       1633
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974841590"
     variation       1636
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151183169"
     variation       1654
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:930948150"
     variation       1655
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049544110"
     variation       1657
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423239840"
     variation       1666
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172239927"
     variation       1668
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478509690"
     variation       1673
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:889530676"
     variation       1683
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584963071"
     variation       1686
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1248792031"
     variation       1689
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584963074"
     variation       1691
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177236852"
     variation       1695
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457702232"
     variation       1697
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479453402"
     variation       1699
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1584963084"
     variation       1703
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:568974922"
     variation       1727
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199909798"
     variation       1728
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459614727"
     variation       1737
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943874680"
     variation       1746
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954879743"
     variation       1749
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040843399"
     variation       1754
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394084499"
     variation       1756
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485196146"
     exon            1758..1902
                     /gene="FEZF1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       1758
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777163567"
     variation       1759
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575757867"
     variation       1763
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:996227894"
     variation       1764
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433315344"
     variation       1768
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147881897"
     variation       1775
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376377447"
     variation       1778
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1030832366"
     variation       1779
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1584963303"
     variation       1797
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1001493630"
     variation       1798
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034290083"
     variation       1807
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:989250880"
     variation       1812
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895902042"
     variation       1813
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247163724"
     variation       1814
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584963321"
     variation       1819
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1223646722"
     variation       1821
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316031673"
     variation       1827
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762185500"
     variation       1830
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191843262"
     variation       1835
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359297542"
     variation       1840
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383381273"
     variation       1844
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385412068"
     variation       1846..1847
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1584963337"
     variation       1848
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979336022"
     variation       1850
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1294533447"
     variation       1858
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184071868"
     variation       1867
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:962275902"
     variation       1869
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1169274071"
     variation       1871
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465697278"
     variation       1872..1876
                     /gene="FEZF1-AS1"
                     /replace="tg"
                     /replace="tgatg"
                     /db_xref="dbSNP:1425279211"
     variation       1873
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375383096"
     variation       1882
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027914088"
     variation       1887
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584963358"
     variation       1892
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231891248"
     variation       1894
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348255257"
     variation       1898
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192771546"
     exon            1903..2088
                     /gene="FEZF1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       1906
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369337815"
     variation       1911..1915
                     /gene="FEZF1-AS1"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1283610728"
     variation       1911
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:542753548"
     variation       1913
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032719618"
     variation       1914
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052036343"
     variation       1915
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225494627"
     variation       1919
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354314662"
     variation       1926
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777545674"
     variation       1932
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415623506"
     variation       1936
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958564858"
     variation       1946
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574820699"
     variation       1947
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917176041"
     variation       1954
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346264483"
     variation       1964
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161940039"
     variation       1965
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949982243"
     variation       1966
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:972102065"
     variation       1968
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474773396"
     variation       1972
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584963736"
     variation       1979
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475974359"
     variation       1980
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540544631"
     variation       1983
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930611562"
     variation       1984
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:904651314"
     variation       1986
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772175732"
     variation       1989
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219248881"
     variation       1990
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889172278"
     variation       2002
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11767283"
     variation       2003
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430226845"
     variation       2007
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:576434421"
     variation       2014
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894501701"
     variation       2016
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:902107445"
     variation       2017
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545492233"
     variation       2018
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1416554537"
     variation       2022
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1363066246"
     variation       2029
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291040118"
     variation       2031
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970963188"
     variation       2034
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1584963781"
     variation       2037
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528711730"
     variation       2050
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349863609"
     variation       2055
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325920801"
     variation       2059
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325959859"
     variation       2065
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428686761"
     variation       2072
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420969016"
     variation       2081
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004751567"
     variation       2082
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014667802"
     variation       2083
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021189280"
     variation       2084
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1189310681"
     exon            2089..2159
                     /gene="FEZF1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       2089
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017539011"
     variation       2102
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:961360789"
     variation       2104
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111816335"
     variation       2110
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762397192"
     variation       2119
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234186163"
     variation       2122
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552266097"
     variation       2125
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145246895"
     variation       2134
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207021247"
     variation       2135
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867220598"
     variation       2142
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252539061"
     variation       2144
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050786920"
     variation       2149
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346318231"
     variation       2150
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967097436"
     variation       2158
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185632278"
     variation       2159
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978168603"
     exon            2160..2653
                     /gene="FEZF1-AS1"
                     /inference="alignment:Splign:2.1.0"
     variation       2161
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951510709"
     variation       2163..2166
                     /gene="FEZF1-AS1"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:58122651"
     variation       2164
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1584964858"
     variation       2165
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1399642056"
     variation       2172
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388799215"
     variation       2175
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1160891677"
     variation       2177
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1474057408"
     variation       2192
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:928248772"
     variation       2211..2213
                     /gene="FEZF1-AS1"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:772016139"
     variation       2211
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1005827950"
     variation       2213
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182244477"
     variation       2218..2224
                     /gene="FEZF1-AS1"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1473697664"
     variation       2225
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017195607"
     variation       2232
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410286985"
     variation       2249
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292759920"
     variation       2255
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268891682"
     variation       2274
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037277447"
     variation       2280
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371471408"
     variation       2281
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777670509"
     variation       2287
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573719834"
     variation       2289
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:527857909"
     variation       2300..2302
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1229283952"
     variation       2300
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921703366"
     variation       2303
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:954585022"
     variation       2315
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268915380"
     variation       2322
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430697875"
     variation       2324
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563045680"
     variation       2326
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307337053"
     variation       2327
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202853393"
     variation       2333
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889981162"
     variation       2346
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143348288"
     variation       2347
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165164854"
     variation       2364
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570730144"
     variation       2365
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406899029"
     variation       2366
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187786718"
     variation       2372
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007348342"
     variation       2383
                     /gene="FEZF1-AS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1256222969"
     variation       2386
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1471505392"
     variation       2388..2393
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="actgaa"
                     /db_xref="dbSNP:1183287016"
     variation       2394
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1450072162"
     variation       2410
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584964939"
     variation       2411
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757014084"
     variation       2414..2419
                     /gene="FEZF1-AS1"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1584964945"
     variation       2415
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1414051456"
     variation       2421
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409223283"
     variation       2428
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923800447"
     variation       2429
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041143216"
     variation       2436..2439
                     /gene="FEZF1-AS1"
                     /replace="tgat"
                     /replace="tgatgat"
                     /db_xref="dbSNP:1246371008"
     variation       2438
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430353662"
     variation       2446
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312152534"
     variation       2447
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584964968"
     variation       2448
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935162750"
     variation       2451
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539706833"
     variation       2464
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999521638"
     variation       2465
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228288305"
     variation       2469
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053666361"
     variation       2474
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031531264"
     variation       2475
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299086721"
     variation       2476
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915127433"
     variation       2479
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955985045"
     variation       2480
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285070019"
     variation       2482..2485
                     /gene="FEZF1-AS1"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:747039462"
     variation       2482
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438219060"
     variation       2485..2489
                     /gene="FEZF1-AS1"
                     /replace="t"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1352539435"
     variation       2495
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778636526"
     variation       2496
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1169502174"
     variation       2505
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1584965006"
     variation       2520
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430255905"
     variation       2525
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1391986262"
     variation       2527
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011460661"
     variation       2529
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1584965013"
     variation       2533
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138934637"
     variation       2548
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1867335"
     variation       2552
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191993965"
     variation       2553
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231473213"
     variation       2557
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535472010"
     variation       2561
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343258895"
     variation       2566
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928436185"
     variation       2576
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555483895"
     variation       2584
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115266018"
     variation       2590..2595
                     /gene="FEZF1-AS1"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1232802488"
     variation       2590
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972423689"
     variation       2595
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1301441358"
     variation       2598
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887310131"
     variation       2602
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1005715531"
     variation       2606
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017205514"
     variation       2619
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:541149247"
     variation       2623
                     /gene="FEZF1-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995873458"
     variation       2625
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776803656"
     variation       2627
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029106189"
     variation       2628
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211612102"
     variation       2631
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410234414"
     variation       2633
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1372234689"
     variation       2639
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1237485031"
     variation       2640
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310964669"
     variation       2641
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954385580"
     variation       2646
                     /gene="FEZF1-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358643520"
     variation       2648
                     /gene="FEZF1-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80320650"
ORIGIN      
gaaaactttgggcttggcattaggagagcctcggctgaaatccgaggttttgaacgcgattttttccgacagaagctgggcgctttctttcatgtaatgctgcagctgagcctgggacaggtctttgaaagctactccagaagggtatttctccaccgccgggaccaccagtttattcctttcggctaaatacgtttttggctgcgggtgcaaaggggaactgaggaagtaggaggccaccgggtggatgttcacgccggctgccgggtggcatgggccgtcacctcggttcaggtagcacaaggcgcccatggcgtggaatgaagagtggttgaccacacgcggccttaccagcttgtactgctgcagcggcagcgcgtcgcgggccaggtcgcccttgagactcagtgcgcagttgagcaggtcgctgcagctgaatgcgggagccgagggcaccgccgcgggcgccgccggggcctccagactggccttccgcggctcggagcccgtcactcctgccttggggctcgtgtcgtaggccacaggcacgaaggggatcatgcaggggatcgacgagttgagatgcagagagtgcttgggttcccccttggcatcaccagccgaacctgcctgcccagcccaatggactcctgccagcccatcgcagagttcttggcgcaccaatgactcggggacaatcactacttatttctatcaatagaaagtgttgtgtcaataacgcagccaagatctcgccaatcgttaacttccaagaggagaagggctcggggttgcccgctcccggaatcccggagtctccgcggcccgaaccgagtctggaccatttagaagacgccggcaggtaactggcctccccaaacgccccgaaaattaaaagccttaggaggcttgttctgtgtttgtggttttgtaaaggcaatgcccgcggcaataggcctgggaaagtcgcactttcatccacaaagttgaggagttgcaaggaataattgggtgtcacaccacaagcaaccttgactcgatcggaccccacccaggatacacacagacgcgcgcgcgcgcacgcttccgagtttccattgagagtctggaaagagcatttctttcttaagtacctgcgctcagctagagctctcccggagcattttaaatactgaatgccgagcggagaagggaaacagagtgtattaatccccactccggttgccggtgtctgcaagcctcctctaagcagcgcaggcggcagcctggatgtctgtgcgcatcaaggagacttgccggcgccagagttgtgtccacaggtgcacttgtgcctcccaaagagcgcgcgtagagaccatttcccctgcaacgccccccagccgaacacccgccgggtgtggcacctcggccgaaactcctggggcggcgcggtggagcgtgtggaggtttccgggaagacgcctacggctgcggctccgactgtgcgggctcccgccgcccaggcaagagcgtccaggagcgcgctggaagctgcggcgcgcaccttccccggcgcagtctcttgccagccggcgatcacgcagagctgaaccccgcagctaggcgcgcaggaagggctgcacagagtttgaagacacggcagctgtaagctggcgtgaggaggccaaaggagcgcgcagagctgcaagcaaagggcggtggggcctggaccctgaagtgagtggccgaccgcagcagctcaaggtgccatctgcctggcaagctacccgggtccctccgccccactctaactttccgcgaaaatcagttccgcctctgccccaagagccaagaggggtggaaaggaagagagcttgggctgggaacgcgcctgatgtctaacagaaaggcagtggcagctggcgaaaaatccccctcctgctgcactcctccgccaccgggctaggttgaaaggaaaaagccaagaagcgcgaagcagcccggctctggaaggctttggagagtccagctgacttgtacacaattcgcggcctctggagccttacctgccttcttgactgaatgccaccagttcgttttacgcttgtggctttttgttgaagtccctatcataagcaaatgcagtttctggctatggttactgcaattcgaaataaaaggcctgtgaggtgtgtccctccagactgagaggctatgactcagggttggactttatggaaaaaaagaagtttataaaacaagtaacccagtttctccaacctttactgtggagcaacagcgtcaagcaacaaaacccagcaaagttttgcttgtcacttacaagggtgttactgaaatctggaaggcgaacaattagaagatagcccaaacatgctctattgctctacactgaaatacttgcctccaataatagaaaaaacctgttttcgtgcaattgattgattagcgttctgcagcagtccctggacaattttaaagacattttgtgtttgtggccaaaattagaaacaagcagacacacacacaaaacaaccatattcaagacacggttcgactgtttccttgacactacccacgaagtttaaagcattttttatgttattttcaaactttcttaagtgatcccatgaaataaaagtcgataatagaaatt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]