2024-05-18 15:04:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_034295 100 bp RNA linear INV 04-JUL-2020 DEFINITION Apis mellifera microRNA mir-375 (Mir375), microRNA. ACCESSION NR_034295 NR_039403 VERSION NR_034295.1 KEYWORDS RefSeq. SOURCE Apis mellifera (honey bee) ORGANISM Apis mellifera Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Apis. REFERENCE 1 (bases 1 to 100) AUTHORS Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE and Ben-Shahar Y. TITLE Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome JOURNAL Genes Brain Behav. 11 (6), 660-670 (2012) PUBMED 22409512 REFERENCE 2 (bases 1 to 100) AUTHORS Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J and Elsik CG. TITLE Computational and transcriptional evidence for microRNAs in the honey bee genome JOURNAL Genome Biol. 8 (6), R97 (2007) PUBMED 17543122 REFERENCE 3 (bases 1 to 100) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from QIUM02000014.1. On Sep 3, 2011 this sequence version replaced NR_039403.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-100 QIUM02000014.1 2479874-2479973 c FEATURES Location/Qualifiers source 1..100 /organism="Apis mellifera" /mol_type="transcribed RNA" /db_xref="taxon:7460" /map="LG3" /linkage_group="LG3" gene 1..100 /gene="Mir375" /gene_synonym="ame-mir-375" /note="microRNA mir-375" /db_xref="GeneID:100315687" /db_xref="miRBase:MI0005740" precursor_RNA 1..100 /gene="Mir375" /gene_synonym="ame-mir-375" /product="microRNA mir-375" /db_xref="GeneID:100315687" /db_xref="miRBase:MI0005740" exon 1..100 /gene="Mir375" /gene_synonym="ame-mir-375" /inference="alignment:Splign:2.1.0" ncRNA 63..84 /ncRNA_class="miRNA" /gene="Mir375" /gene_synonym="ame-mir-375" /product="ame-miR-375" /db_xref="miRBase:MIMAT0004431" /db_xref="GeneID:100315687" /db_xref="miRBase:MI0005740" ORIGIN
atcgattgaattatcagtttggtgcatcgatcctaacgatcaacaaacttttcacttgaaagtttgttcgttcggctcgagttatcaaactgaatggatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]