LOCUS       NR_032498                 64 bp    RNA     linear   PRI 11-JUL-2020
DEFINITION  Macaca mulatta microRNA mir-375 (MIR375), microRNA.
ACCESSION   NR_032498
VERSION     NR_032498.1
KEYWORDS    RefSeq.
SOURCE      Macaca mulatta (Rhesus monkey)
  ORGANISM  Macaca mulatta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Macaca.
REFERENCE   1  (bases 1 to 64)
  AUTHORS   Yue J, Sheng Y and Orwig KE.
  TITLE     Identification of novel homologous microRNA genes in the rhesus
            macaque genome
  JOURNAL   BMC Genomics 9, 8 (2008)
   PUBMED   18186931
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 64)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from QNVO02000079.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-64                QNVO02000079.1     81809925-81809988   c
FEATURES             Location/Qualifiers
     source          1..64
                     /organism="Macaca mulatta"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9544"
                     /chromosome="12"
                     /map="12"
     gene            1..64
                     /gene="MIR375"
                     /gene_synonym="mml-mir-375"
                     /note="microRNA mir-375"
                     /db_xref="GeneID:100315529"
                     /db_xref="miRBase:MI0007720"
     precursor_RNA   1..64
                     /gene="MIR375"
                     /gene_synonym="mml-mir-375"
                     /product="microRNA mir-375"
                     /db_xref="GeneID:100315529"
                     /db_xref="miRBase:MI0007720"
     exon            1..64
                     /gene="MIR375"
                     /gene_synonym="mml-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           40..61
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="mml-mir-375"
                     /product="mml-miR-375"
                     /db_xref="miRBase:MIMAT0006302"
                     /db_xref="GeneID:100315529"
                     /db_xref="miRBase:MI0007720"
ORIGIN      

ccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggc

//