LOCUS       NR_032271                 75 bp    RNA     linear   ROD 24-DEC-2023
DEFINITION  Rattus norvegicus microRNA 375 (Mir375), microRNA.
ACCESSION   NR_032271
VERSION     NR_032271.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 75)
  AUTHORS   Sun X, Mi L, Du G, Sun C and He S.
  TITLE     Platelet-rich plasma treatment alleviates osteoarthritis-related
            pain, inflammation, and apoptosis by upregulating the expression
            levels of microRNA-375 and microRNA-337
  JOURNAL   Immunopharmacol Immunotoxicol 44 (1), 87-98 (2022)
   PUBMED   34845965
  REMARK    GeneRIF: Platelet-rich plasma treatment alleviates
            osteoarthritis-related pain, inflammation, and apoptosis by
            upregulating the expression levels of microRNA-375 and
            microRNA-337.
REFERENCE   2  (bases 1 to 75)
  AUTHORS   Xu L, Li G, Tang X, Feng C, Li M, Jiang X, Gu Y, Yun Y, Lu L, Feng
            X, Ding X and Sun B.
  TITLE     MiR-375-3p mediates reduced pineal function in hypoxia-ischemia
            brain damage
  JOURNAL   Exp Neurol 344, 113814 (2021)
   PUBMED   34280452
  REMARK    GeneRIF: MiR-375-3p mediates reduced pineal function in
            hypoxia-ischemia brain damage.
REFERENCE   3  (bases 1 to 75)
  AUTHORS   Han KH, Cho H, Han KR, Mun SK, Kim YK, Park I and Chang M.
  TITLE     Role of microRNA-375-3p-mediated regulation in tinnitus development
  JOURNAL   Int J Mol Med 48 (1) (2021)
   PUBMED   34036397
  REMARK    GeneRIF: Role of microRNA3753pmediated regulation in tinnitus
            development.
REFERENCE   4  (bases 1 to 75)
  AUTHORS   Gezginci-Oktayoglu S, Sancar S, Karatug-Kacar A and Bolkent S.
  TITLE     miR-375 induces adipogenesis through targeting Erk1 in pancreatic
            duct cells under the influence of sodium palmitate
  JOURNAL   J Cell Physiol 236 (5), 3881-3895 (2021)
   PUBMED   33107061
  REMARK    GeneRIF: miR-375 induces adipogenesis through targeting Erk1 in
            pancreatic duct cells under the influence of sodium palmitate.
REFERENCE   5  (bases 1 to 75)
  AUTHORS   Li Y, Li X, Wang L, Han N and Yin G.
  TITLE     miR-375-3p contributes to hypoxia-induced apoptosis by targeting
            forkhead box P1 (FOXP1) and Bcl2 like protein 2 (Bcl2l2) in rat
            cardiomyocyte h9c2 cells
  JOURNAL   Biotechnol Lett 43 (2), 353-367 (2021)
   PUBMED   33128129
  REMARK    GeneRIF: miR-375-3p contributes to hypoxia-induced apoptosis by
            targeting forkhead box P1 (FOXP1) and Bcl2 like protein 2 (Bcl2l2)
            in rat cardiomyocyte h9c2 cells.
REFERENCE   6  (bases 1 to 75)
  AUTHORS   Linsen SE, de Wit E, de Bruijn E and Cuppen E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 75)
  AUTHORS   Bravo-Egana V, Rosero S, Molano RD, Pileggi A, Ricordi C,
            Dominguez-Bendala J and Pastori RL.
  TITLE     Quantitative differential expression analysis reveals miR-7 as
            major islet microRNA
  JOURNAL   Biochem Biophys Res Commun 366 (4), 922-926 (2008)
   PUBMED   18086561
  REMARK    GeneRIF: miR-7 is the most abundant endocrine miRNA in islets while
            miR-375 is the most abundant intra-islet miRNA.
REFERENCE   8  (bases 1 to 75)
  AUTHORS   Lynn FC, Skewes-Cox P, Kosaka Y, McManus MT, Harfe BD and German
            MS.
  TITLE     MicroRNA expression is required for pancreatic islet cell genesis
            in the mouse
  JOURNAL   Diabetes 56 (12), 2938-2945 (2007)
   PUBMED   17804764
REFERENCE   9  (bases 1 to 75)
  AUTHORS   Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
            Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
            Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
            Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
            M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
            V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
            Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
            Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
            Zavolan M and Tuschl T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   10 (bases 1 to 75)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JACYVU010000215.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-75                JACYVU010000215.1  9527602-9527676     c
FEATURES             Location/Qualifiers
     source          1..75
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="9"
                     /map="9q33"
     gene            1..75
                     /gene="Mir375"
                     /gene_synonym="rno-mir-375"
                     /note="microRNA 375"
                     /db_xref="GeneID:100314263"
                     /db_xref="miRBase:MI0006140"
                     /db_xref="RGD:2325360"
     precursor_RNA   1..75
                     /gene="Mir375"
                     /gene_synonym="rno-mir-375"
                     /product="microRNA 375"
                     /db_xref="GeneID:100314263"
                     /db_xref="miRBase:MI0006140"
                     /db_xref="RGD:2325360"
     exon            1..75
                     /gene="Mir375"
                     /gene_synonym="rno-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           10..32
                     /ncRNA_class="miRNA"
                     /gene="Mir375"
                     /gene_synonym="rno-mir-375"
                     /product="rno-miR-375-5p"
                     /db_xref="miRBase:MIMAT0017301"
                     /db_xref="GeneID:100314263"
                     /db_xref="miRBase:MI0006140"
                     /db_xref="RGD:2325360"
     ncRNA           45..66
                     /ncRNA_class="miRNA"
                     /gene="Mir375"
                     /gene_synonym="rno-mir-375"
                     /product="rno-miR-375-3p"
                     /db_xref="miRBase:MIMAT0005307"
                     /db_xref="GeneID:100314263"
                     /db_xref="miRBase:MI0006140"
                     /db_xref="RGD:2325360"
ORIGIN      

tccggccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggcaggggc

//