LOCUS       NR_031552                 65 bp    RNA     linear   VRT 01-DEC-2021
DEFINITION  Gallus gallus microRNA 375 (MIR375), microRNA.
ACCESSION   NR_031552
VERSION     NR_031552.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 65)
  AUTHORS   Li H, Shang H, Shu D, Zhang H, Ji J, Sun B, Li H and Xie Q.
  TITLE     gga-miR-375 plays a key role in tumorigenesis post subgroup J avian
            leukosis virus infection
  JOURNAL   PLoS One 9 (4), e90878 (2014)
   PUBMED   24694742
  REMARK    GeneRIF: data suggests that gga-miR-375 may function as a tumour
            suppressor thereby regulating cancer cell proliferation and it
            plays a key role in avian leukosis tumorigenesis.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 65)
  AUTHORS   Song J, Kim D, Chun CH and Jin EJ.
  TITLE     MicroRNA-375, a new regulator of cadherin-7, suppresses the
            migration of chondrogenic progenitors
  JOURNAL   Cell Signal 25 (3), 698-706 (2013)
   PUBMED   23178988
  REMARK    GeneRIF: MiR-375 was necessary and sufficient to down-regulate cell
            migration through negative regulation of cadherin-7 by the direct
            interaction with 3' UTR of cadherin-7.
            Erratum:[Cell Signal. 2020 Mar;67:109480. PMID: 31776059]
REFERENCE   3  (bases 1 to 65)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAENSK010000236.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609609.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-65                JAENSK010000236.1  14605504-14605568
FEATURES             Location/Qualifiers
     source          1..65
                     /organism="Gallus gallus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9031"
                     /chromosome="7"
                     /map="7"
     gene            1..65
                     /gene="MIR375"
                     /gene_synonym="gga-mir-375; mir-375; MIRN375"
                     /note="microRNA 375"
                     /db_xref="CGNC:59184"
                     /db_xref="GeneID:777903"
                     /db_xref="miRBase:MI0003705"
     precursor_RNA   1..65
                     /gene="MIR375"
                     /gene_synonym="gga-mir-375; mir-375; MIRN375"
                     /product="microRNA 375"
                     /db_xref="GeneID:777903"
                     /db_xref="CGNC:59184"
                     /db_xref="miRBase:MI0003705"
     exon            1..65
                     /gene="MIR375"
                     /gene_synonym="gga-mir-375; mir-375; MIRN375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           41..62
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="gga-mir-375; mir-375; MIRN375"
                     /product="gga-miR-375"
                     /db_xref="miRBase:MIMAT0003362"
                     /db_xref="CGNC:59184"
                     /db_xref="GeneID:777903"
                     /db_xref="miRBase:MI0003705"
ORIGIN      

cctggcgtcgagccccacgtgcaagacctgacctgaacgttttgttcgttcggctcgcgttaggc

//