LOCUS       NR_031317                 64 bp    RNA     linear   MAM 04-JUL-2020
DEFINITION  Bos taurus microRNA mir-375 (MIR375), microRNA.
ACCESSION   NR_031317
VERSION     NR_031317.1
KEYWORDS    RefSeq.
SOURCE      Bos taurus (cattle)
  ORGANISM  Bos taurus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
            Pecora; Bovidae; Bovinae; Bos.
REFERENCE   1  (bases 1 to 64)
  AUTHORS   Zhang J, Guan Y, Shen C, Zhang L and Wang X.
  TITLE     MicroRNA-375 regulates oocyte in vitro maturation by targeting
            ADAMTS1 and PGR in bovine cumulus cells
  JOURNAL   Biomed. Pharmacother. 118, 109350 (2019)
   PUBMED   31545267
  REMARK    GeneRIF: miR-375 represses oocyte in vitro maturation at least
            partially through targeting ADAMTS1 and PGR in cumulus cells.
REFERENCE   2  (bases 1 to 64)
  AUTHORS   Liu C, Yuan B, Chen H, Xu M, Sun X, Xu J, Gao Y, Chen C, Jiang H
            and Zhang J.
  TITLE     Effects of MiR-375-BMPR2 as a Key Factor Downstream of BMP15/GDF9
            on the Smad1/5/8 and Smad2/3 Signaling Pathways
  JOURNAL   Cell. Physiol. Biochem. 46 (1), 213-225 (2018)
   PUBMED   29587293
  REMARK    GeneRIF: High levels of miR-375 resulted in increased expression of
            ALK4 and decreased expression of PTX3, HAS2 and PTGS2, whereas
            miR-375 inhibition resulted in the opposite results.
REFERENCE   3  (bases 1 to 64)
  AUTHORS   Jin W, Grant JR, Stothard P, Moore SS and Guan LL.
  TITLE     Characterization of bovine miRNAs by sequencing and bioinformatics
            analysis
  JOURNAL   BMC Mol. Biol. 10, 90 (2009)
   PUBMED   19758457
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 64)
  AUTHORS   Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K
            and Hoelker M.
  TITLE     Identification and expression profiling of microRNAs during bovine
            oocyte maturation using heterologous approach
  JOURNAL   Mol. Reprod. Dev. 76 (7), 665-677 (2009)
   PUBMED   19170227
REFERENCE   5  (bases 1 to 64)
  AUTHORS   Strozzi F, Mazza R, Malinverni R and Williams JL.
  TITLE     Annotation of 390 bovine miRNA genes by sequence similarity with
            other species
  JOURNAL   Anim. Genet. 40 (1), 125 (2009)
   PUBMED   18945293
REFERENCE   6  (bases 1 to 64)
  AUTHORS   Artzi S, Kiezun A and Shomron N.
  TITLE     miRNAminer: a tool for homologous microRNA gene search
  JOURNAL   BMC Bioinformatics 9, 39 (2008)
   PUBMED   18215311
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 64)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from NKLS02000002.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM610437.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-64                NKLS02000002.1     106945887-106945950 c
FEATURES             Location/Qualifiers
     source          1..64
                     /organism="Bos taurus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9913"
                     /chromosome="2"
                     /map="2"
                     /breed="Hereford"
     gene            1..64
                     /gene="MIR375"
                     /gene_synonym="bta-mir-375; mir-375"
                     /note="microRNA mir-375"
                     /db_xref="GeneID:100313041"
                     /db_xref="miRBase:MI0009817"
     precursor_RNA   1..64
                     /gene="MIR375"
                     /gene_synonym="bta-mir-375; mir-375"
                     /product="microRNA mir-375"
                     /db_xref="GeneID:100313041"
                     /db_xref="miRBase:MI0009817"
     exon            1..64
                     /gene="MIR375"
                     /gene_synonym="bta-mir-375; mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           39..61
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="bta-mir-375; mir-375"
                     /product="bta-miR-375"
                     /db_xref="miRBase:MIMAT0009303"
                     /db_xref="GeneID:100313041"
                     /db_xref="miRBase:MI0009817"
ORIGIN      

ccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggc

//