ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-22 20:18:24, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_030428 76 bp RNA linear ROD 06-AUG-2023
DEFINITION Mus musculus microRNA 762 (Mir762), microRNA.
ACCESSION NR_030428
VERSION NR_030428.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 76)
AUTHORS Wang C, Chen Y, Cheng NT, Yang ZT, Tang HX and Xu M.
TITLE MicroRNA-762 Modulates Lipopolysaccharide-induced Acute Lung Injury
via SIRT7
JOURNAL Immunol Invest 51 (5), 1407-1422 (2022)
PUBMED 34251977
REMARK GeneRIF: MicroRNA-762 Modulates Lipopolysaccharide-induced Acute
Lung Injury via SIRT7.
REFERENCE 2 (bases 1 to 76)
AUTHORS Khan A, Yuewen W, Dil S, Shah W, Shi Q and Khan R.
TITLE The evolutionarily conserved gene, Fam114a2, is dispensable for
fertility in mouse
JOURNAL Reprod Biol 21 (3), 100531 (2021)
PUBMED 34315090
REMARK GeneRIF: The evolutionarily conserved gene, Fam114a2, is
dispensable for fertility in mouse.
REFERENCE 3 (bases 1 to 76)
AUTHORS Lai PS, Chang WM, Chen YY, Lin YF, Liao HF and Chen CY.
TITLE Circulating microRNA-762 upregulation in colorectal cancer may be
accompanied by Wnt-1/beta-catenin signaling
JOURNAL Cancer Biomark 32 (2), 111-122 (2021)
PUBMED 34092606
REMARK GeneRIF: Circulating microRNA-762 upregulation in colorectal cancer
may be accompanied by Wnt-1/beta-catenin signaling.
REFERENCE 4 (bases 1 to 76)
AUTHORS Gao H, Ni N, Zhang D, Wang Y, Tang Z, Sun N, Ju Y, Dai X, Zhang Y,
Liu Y and Gu P.
TITLE miR-762 regulates the proliferation and differentiation of retinal
progenitor cells by targeting NPDC1
JOURNAL Cell Cycle 19 (14), 1754-1767 (2020)
PUBMED 32544377
REMARK GeneRIF: miR-762 regulates the proliferation and differentiation of
retinal progenitor cells by targeting NPDC1.
REFERENCE 5 (bases 1 to 76)
AUTHORS Qiang Z, Jin B, Peng Y, Zhang Y, Wang J, Chen C, Wang X and Liu F.
TITLE miR-762 modulates thyroxine-induced cardiomyocyte hypertrophy by
inhibiting Beclin-1
JOURNAL Endocrine 66 (3), 585-595 (2019)
PUBMED 31522342
REMARK GeneRIF: modulates thyroxine-induced cardiomyocyte hypertrophy by
inhibiting Beclin-1
Erratum:[Endocrine. 2020 Feb;67(2):503-505. PMID: 31939092]
REFERENCE 6 (bases 1 to 76)
AUTHORS Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA,
Rusyn I and Beland FA.
TITLE Difference in expression of hepatic microRNAs miR-29c, miR-34a,
miR-155, and miR-200b is associated with strain-specific
susceptibility to dietary nonalcoholic steatohepatitis in mice
JOURNAL Lab Invest 90 (10), 1437-1446 (2010)
PUBMED 20548288
REFERENCE 7 (bases 1 to 76)
AUTHORS Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H and
Yoshikawa T.
TITLE The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal
muscle in response to physical activity
JOURNAL Am J Physiol Endocrinol Metab 298 (4), E799-E806 (2010)
PUBMED 20086200
REFERENCE 8 (bases 1 to 76)
AUTHORS van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH,
Marshall WS, Hill JA and Olson EN.
TITLE Dysregulation of microRNAs after myocardial infarction reveals a
role of miR-29 in cardiac fibrosis
JOURNAL Proc Natl Acad Sci U S A 105 (35), 13027-13032 (2008)
PUBMED 18723672
REFERENCE 9 (bases 1 to 76)
AUTHORS Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L,
Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van
Zonneveld AJ, Mano H, Plasterk R and Cuppen E.
TITLE Many novel mammalian microRNA candidates identified by extensive
cloning and RAKE analysis
JOURNAL Genome Res 16 (10), 1289-1298 (2006)
PUBMED 16954537
REFERENCE 10 (bases 1 to 76)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC124507.4.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: SRR7345562.1695843.1,
SRR7652917.971371.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-76 AC124507.4 169107-169182
FEATURES Location/Qualifiers
source 1..76
/organism="Mus musculus"
/mol_type="transcribed RNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="7"
/map="7 69.68 cM"
gene 1..76
/gene="Mir762"
/gene_synonym="mir-762; Mirn762; mmu-mir-762"
/note="microRNA 762"
/db_xref="GeneID:791073"
/db_xref="MGI:MGI:3691607"
/db_xref="miRBase:MI0004215"
precursor_RNA 1..76
/gene="Mir762"
/gene_synonym="mir-762; Mirn762; mmu-mir-762"
/product="microRNA 762"
/db_xref="GeneID:791073"
/db_xref="MGI:MGI:3691607"
/db_xref="miRBase:MI0004215"
exon 1..76
/gene="Mir762"
/gene_synonym="mir-762; Mirn762; mmu-mir-762"
/inference="alignment:Splign:2.1.0"
ncRNA 48..69
/ncRNA_class="miRNA"
/gene="Mir762"
/gene_synonym="mir-762; Mirn762; mmu-mir-762"
/product="mmu-miR-762"
/db_xref="miRBase:MIMAT0003892"
/db_xref="GeneID:791073"
/db_xref="MGI:MGI:3691607"
/db_xref="miRBase:MI0004215"
ORIGIN
gcccggctccgggtctcggcccgcacggtccggccggccatgctggcggggctggggccgggacagagcccgtggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]