GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 07:43:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_030343                100 bp    RNA     linear   PRI 20-JUN-2024
DEFINITION  Homo sapiens microRNA 612 (MIR612), microRNA.
ACCESSION   NR_030343
VERSION     NR_030343.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 100)
  AUTHORS   Zhao,Y., Xu,L., Wang,Q., Li,C., Zhang,T., Xing,S. and Yu,X.
  TITLE     LINC01061 triggers inflammation and inflammasome activation in
            autoimmune thyroiditis via microRNA-612/BRD4 axis
  JOURNAL   Int Immunopharmacol 111, 109050 (2022)
   PUBMED   35998503
  REMARK    GeneRIF: LINC01061 triggers inflammation and inflammasome
            activation in autoimmune thyroiditis via microRNA-612/BRD4 axis.
REFERENCE   2  (bases 1 to 100)
  AUTHORS   Ayon-Perez,M.F., Gomez-Gomez,Y., Organista-Nava,J.,
            Leyva-Vazquez,M.A., Zambrano-Zaragoza,J.F., Reyes-Fregoso,J.C.,
            Agraz-Cibrian,J.M., Gutierrez-Franco,J., Victorio-De Los Santos,M.
            and Vazquez-Reyes,A.
  TITLE     Association of MIR3117 and MIR612 Genes Polymorphisms with
            Childhood Acute Lymphoblastic Leukemia in the Mexican Population
  JOURNAL   Arch Med Res 53 (6), 603-609 (2022)
   PUBMED   36002354
  REMARK    GeneRIF: Association of MIR3117 and MIR612 Genes Polymorphisms with
            Childhood Acute Lymphoblastic Leukemia in the Mexican Population.
REFERENCE   3  (bases 1 to 100)
  AUTHORS   Ge,L., Xun,C., Li,W., Jin,S., Liu,Z., Zhuo,Y., Duan,D., Hu,Z.,
            Chen,P. and Lu,M.
  TITLE     Extracellular vesicles derived from hypoxia-preconditioned
            olfactory mucosa mesenchymal stem cells enhance angiogenesis via
            miR-612
  JOURNAL   J Nanobiotechnology 19 (1), 380 (2021)
   PUBMED   34802444
  REMARK    GeneRIF: Extracellular vesicles derived from hypoxia-preconditioned
            olfactory mucosa mesenchymal stem cells enhance angiogenesis via
            miR-612.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 100)
  AUTHORS   Li,J., Huang,S., Zhang,Y., Zhuo,W., Tong,B. and Cai,F.
  TITLE     LINC00460 Enhances Bladder Carcinoma Cell Proliferation and
            Migration by Modulating miR-612/FOXK1 Axis
  JOURNAL   Pharmacology 106 (1-2), 79-90 (2021)
   PUBMED   33027786
  REMARK    GeneRIF: LINC00460 Enhances Bladder Carcinoma Cell Proliferation
            and Migration by Modulating miR-612/FOXK1 Axis.
REFERENCE   5  (bases 1 to 100)
  AUTHORS   Liu,Y., Lu,L.L., Wen,D., Liu,D.L., Dong,L.L., Gao,D.M., Bian,X.Y.,
            Zhou,J., Fan,J. and Wu,W.Z.
  TITLE     MiR-612 regulates invadopodia of hepatocellular carcinoma by
            HADHA-mediated lipid reprogramming
  JOURNAL   J Hematol Oncol 13 (1), 12 (2020)
   PUBMED   32033570
  REMARK    GeneRIF: MiR-612 regulates invadopodia of hepatocellular carcinoma
            by HADHA-mediated lipid reprogramming.
            Erratum:[J Hematol Oncol. 2020 May 4;13(1):44. doi:
            10.1186/s13045-020-00875-5. PMID: 32366313]
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 100)
  AUTHORS   Gutierrez-Camino,A., Lopez-Lopez,E., Martin-Guerrero,I.,
            Pinan,M.A., Garcia-Miguel,P., Sanchez-Toledo,J., Carbone
            Baneres,A., Uriz,J., Navajas,A. and Garcia-Orad,A.
  TITLE     Noncoding RNA-related polymorphisms in pediatric acute
            lymphoblastic leukemia susceptibility
  JOURNAL   Pediatr Res 75 (6), 767-773 (2014)
   PUBMED   24618566
  REMARK    GeneRIF: rs12803915 in mir-612 exhibited a significant association
            with pediatric acute lymphoblastic leukemia.
REFERENCE   7  (bases 1 to 100)
  AUTHORS   Tao,Z.H., Wan,J.L., Zeng,L.Y., Xie,L., Sun,H.C., Qin,L.X., Wang,L.,
            Zhou,J., Ren,Z.G., Li,Y.X., Fan,J. and Wu,W.Z.
  TITLE     miR-612 suppresses the invasive-metastatic cascade in
            hepatocellular carcinoma
  JOURNAL   J Exp Med 210 (4), 789-803 (2013)
   PUBMED   23478189
  REMARK    GeneRIF: miR-612 is involved in both the initial and final steps of
            the metastatic cascade, by suppressing local invasion and distant
            colonization.
REFERENCE   8  (bases 1 to 100)
  AUTHORS   Kim,H.K., Prokunina-Olsson,L. and Chanock,S.J.
  TITLE     Common genetic variants in miR-1206 (8q24.2) and miR-612 (11q13.3)
            affect biogenesis of mature miRNA forms
  JOURNAL   PLoS One 7 (10), e47454 (2012)
   PUBMED   23077621
  REMARK    GeneRIF: The two SNPs within miR-612 significantly affected
            expression of mature miR-612 in a cell-type specific manner;
            enhancement in prostate cancer cell lines, reduction in colon
            cancer cells, and no effect in breast cancer cell lines.
REFERENCE   9  (bases 1 to 100)
  AUTHORS   Cummins,J.M., He,Y., Leary,R.J., Pagliarini,R., Diaz,L.A. Jr.,
            Sjoblom,T., Barad,O., Bentwich,Z., Szafranska,A.E., Labourier,E.,
            Raymond,C.K., Roberts,B.S., Juhl,H., Kinzler,K.W., Vogelstein,B.
            and Velculescu,V.E.
  TITLE     The colorectal microRNAome
  JOURNAL   Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006)
   PUBMED   16505370
REFERENCE   10 (bases 1 to 100)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AP000769.5.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-100               AP000769.5         10332-10431
FEATURES             Location/Qualifiers
     source          1..100
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q13.1"
     gene            1..100
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /note="microRNA 612"
                     /db_xref="GeneID:693197"
                     /db_xref="HGNC:HGNC:32868"
                     /db_xref="miRBase:MI0003625"
     precursor_RNA   1..100
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /product="microRNA 612"
                     /db_xref="GeneID:693197"
                     /db_xref="HGNC:HGNC:32868"
                     /db_xref="miRBase:MI0003625"
     exon            1..100
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1856747208"
     variation       2
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771270853"
     variation       5
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776967411"
     variation       6
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906784255"
     variation       9
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249942741"
     variation       12
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:550894"
     variation       15
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:2495683947"
     ncRNA           16..40
                     /ncRNA_class="miRNA"
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /product="hsa-miR-612"
                     /db_xref="miRBase:MIMAT0003280"
                     /db_xref="GeneID:693197"
                     /db_xref="HGNC:HGNC:32868"
                     /db_xref="miRBase:MI0003625"
     variation       20
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2134911302"
     variation       21
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168134916"
     variation       23
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2495683967"
     variation       24
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337907735"
     variation       34
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418535165"
     variation       35
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405700548"
     variation       36
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768430062"
     variation       37
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774044559"
     variation       39
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2495683994"
     variation       40
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405130248"
     variation       41
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460832875"
     variation       42
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761689908"
     variation       43
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320726555"
     variation       45
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1856747655"
     variation       48
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366719792"
     variation       50
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1856747707"
     variation       51
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12803915"
     variation       53
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772678689"
     variation       54..57
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:2495684068"
     variation       54
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760246850"
     variation       56
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765936428"
     variation       57
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2495684075"
     variation       58..77
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="ctcca"
                     /replace="ctccaggggccctccctcca"
                     /db_xref="dbSNP:1288140234"
     variation       60
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753475143"
     variation       61
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209901430"
     variation       62
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270109511"
     variation       64
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1856748084"
     variation       66
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368138070"
     variation       67
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765600576"
     variation       71..73
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:2495684114"
     variation       71
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238221464"
     variation       73
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1856748238"
     variation       74
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931547376"
     variation       80..84
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="gc"
                     /replace="gcagc"
                     /db_xref="dbSNP:1183424630"
     variation       83
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2495684119"
     variation       84
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753138876"
     variation       86
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460912837"
     variation       87
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1159734130"
     variation       92..93
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:2495684133"
     variation       93..94
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:2495684138"
     variation       93
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758938351"
     variation       94..95
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace=""
                     /replace="tgtc"
                     /db_xref="dbSNP:2495684140"
     variation       95
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778486713"
     variation       98
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1856748504"
     variation       99
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2495684171"
     variation       100
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2495684176"
ORIGIN      
tcccatctggaccctgctgggcagggcttctgagctccttagcactagcaggaggggctccaggggccctccctccatggcagccaggacaggactctca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]