2025-07-02 10:20:58, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_030343 100 bp RNA linear PRI 20-JUN-2024 DEFINITION Homo sapiens microRNA 612 (MIR612), microRNA. ACCESSION NR_030343 VERSION NR_030343.1 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 100) AUTHORS Zhao,Y., Xu,L., Wang,Q., Li,C., Zhang,T., Xing,S. and Yu,X. TITLE LINC01061 triggers inflammation and inflammasome activation in autoimmune thyroiditis via microRNA-612/BRD4 axis JOURNAL Int Immunopharmacol 111, 109050 (2022) PUBMED 35998503 REMARK GeneRIF: LINC01061 triggers inflammation and inflammasome activation in autoimmune thyroiditis via microRNA-612/BRD4 axis. REFERENCE 2 (bases 1 to 100) AUTHORS Ayon-Perez,M.F., Gomez-Gomez,Y., Organista-Nava,J., Leyva-Vazquez,M.A., Zambrano-Zaragoza,J.F., Reyes-Fregoso,J.C., Agraz-Cibrian,J.M., Gutierrez-Franco,J., Victorio-De Los Santos,M. and Vazquez-Reyes,A. TITLE Association of MIR3117 and MIR612 Genes Polymorphisms with Childhood Acute Lymphoblastic Leukemia in the Mexican Population JOURNAL Arch Med Res 53 (6), 603-609 (2022) PUBMED 36002354 REMARK GeneRIF: Association of MIR3117 and MIR612 Genes Polymorphisms with Childhood Acute Lymphoblastic Leukemia in the Mexican Population. REFERENCE 3 (bases 1 to 100) AUTHORS Ge,L., Xun,C., Li,W., Jin,S., Liu,Z., Zhuo,Y., Duan,D., Hu,Z., Chen,P. and Lu,M. TITLE Extracellular vesicles derived from hypoxia-preconditioned olfactory mucosa mesenchymal stem cells enhance angiogenesis via miR-612 JOURNAL J Nanobiotechnology 19 (1), 380 (2021) PUBMED 34802444 REMARK GeneRIF: Extracellular vesicles derived from hypoxia-preconditioned olfactory mucosa mesenchymal stem cells enhance angiogenesis via miR-612. Publication Status: Online-Only REFERENCE 4 (bases 1 to 100) AUTHORS Li,J., Huang,S., Zhang,Y., Zhuo,W., Tong,B. and Cai,F. TITLE LINC00460 Enhances Bladder Carcinoma Cell Proliferation and Migration by Modulating miR-612/FOXK1 Axis JOURNAL Pharmacology 106 (1-2), 79-90 (2021) PUBMED 33027786 REMARK GeneRIF: LINC00460 Enhances Bladder Carcinoma Cell Proliferation and Migration by Modulating miR-612/FOXK1 Axis. REFERENCE 5 (bases 1 to 100) AUTHORS Liu,Y., Lu,L.L., Wen,D., Liu,D.L., Dong,L.L., Gao,D.M., Bian,X.Y., Zhou,J., Fan,J. and Wu,W.Z. TITLE MiR-612 regulates invadopodia of hepatocellular carcinoma by HADHA-mediated lipid reprogramming JOURNAL J Hematol Oncol 13 (1), 12 (2020) PUBMED 32033570 REMARK GeneRIF: MiR-612 regulates invadopodia of hepatocellular carcinoma by HADHA-mediated lipid reprogramming. Erratum:[J Hematol Oncol. 2020 May 4;13(1):44. doi: 10.1186/s13045-020-00875-5. PMID: 32366313] Publication Status: Online-Only REFERENCE 6 (bases 1 to 100) AUTHORS Gutierrez-Camino,A., Lopez-Lopez,E., Martin-Guerrero,I., Pinan,M.A., Garcia-Miguel,P., Sanchez-Toledo,J., Carbone Baneres,A., Uriz,J., Navajas,A. and Garcia-Orad,A. TITLE Noncoding RNA-related polymorphisms in pediatric acute lymphoblastic leukemia susceptibility JOURNAL Pediatr Res 75 (6), 767-773 (2014) PUBMED 24618566 REMARK GeneRIF: rs12803915 in mir-612 exhibited a significant association with pediatric acute lymphoblastic leukemia. REFERENCE 7 (bases 1 to 100) AUTHORS Tao,Z.H., Wan,J.L., Zeng,L.Y., Xie,L., Sun,H.C., Qin,L.X., Wang,L., Zhou,J., Ren,Z.G., Li,Y.X., Fan,J. and Wu,W.Z. TITLE miR-612 suppresses the invasive-metastatic cascade in hepatocellular carcinoma JOURNAL J Exp Med 210 (4), 789-803 (2013) PUBMED 23478189 REMARK GeneRIF: miR-612 is involved in both the initial and final steps of the metastatic cascade, by suppressing local invasion and distant colonization. REFERENCE 8 (bases 1 to 100) AUTHORS Kim,H.K., Prokunina-Olsson,L. and Chanock,S.J. TITLE Common genetic variants in miR-1206 (8q24.2) and miR-612 (11q13.3) affect biogenesis of mature miRNA forms JOURNAL PLoS One 7 (10), e47454 (2012) PUBMED 23077621 REMARK GeneRIF: The two SNPs within miR-612 significantly affected expression of mature miR-612 in a cell-type specific manner; enhancement in prostate cancer cell lines, reduction in colon cancer cells, and no effect in breast cancer cell lines. REFERENCE 9 (bases 1 to 100) AUTHORS Cummins,J.M., He,Y., Leary,R.J., Pagliarini,R., Diaz,L.A. Jr., Sjoblom,T., Barad,O., Bentwich,Z., Szafranska,A.E., Labourier,E., Raymond,C.K., Roberts,B.S., Juhl,H., Kinzler,K.W., Vogelstein,B. and Velculescu,V.E. TITLE The colorectal microRNAome JOURNAL Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006) PUBMED 16505370 REFERENCE 10 (bases 1 to 100) AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and Enright,A.J. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AP000769.5. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-100 AP000769.5 10332-10431 FEATURES Location/Qualifiers source 1..100 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="11" /map="11q13.1" gene 1..100 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /note="microRNA 612" /db_xref="GeneID:693197" /db_xref="HGNC:HGNC:32868" /db_xref="miRBase:MI0003625" precursor_RNA 1..100 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /product="microRNA 612" /db_xref="GeneID:693197" /db_xref="HGNC:HGNC:32868" /db_xref="miRBase:MI0003625" exon 1..100 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /inference="alignment:Splign:2.1.0" variation 1 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:1856747208" variation 2 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:771270853" variation 5 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:776967411" variation 6 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:906784255" variation 9 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="g" /replace="t" /db_xref="dbSNP:1249942741" variation 12 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /db_xref="dbSNP:550894" variation 15 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="" /replace="t" /db_xref="dbSNP:2495683947" ncRNA 16..40 /ncRNA_class="miRNA" /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /product="hsa-miR-612" /db_xref="miRBase:MIMAT0003280" /db_xref="GeneID:693197" /db_xref="HGNC:HGNC:32868" /db_xref="miRBase:MI0003625" variation 20 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:2134911302" variation 21 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:1168134916" variation 23 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:2495683967" variation 24 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="g" /db_xref="dbSNP:1337907735" variation 34 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:1418535165" variation 35 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:1405700548" variation 36 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:768430062" variation 37 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /db_xref="dbSNP:774044559" variation 39 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:2495683994" variation 40 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:1405130248" variation 41 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:1460832875" variation 42 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:761689908" variation 43 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /db_xref="dbSNP:1320726555" variation 45 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:1856747655" variation 48 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1366719792" variation 50 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:1856747707" variation 51 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:12803915" variation 53 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="t" /db_xref="dbSNP:772678689" variation 54..57 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="ggg" /replace="gggg" /db_xref="dbSNP:2495684068" variation 54 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:760246850" variation 56 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:765936428" variation 57 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:2495684075" variation 58..77 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="ctcca" /replace="ctccaggggccctccctcca" /db_xref="dbSNP:1288140234" variation 60 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:753475143" variation 61 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1209901430" variation 62 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:1270109511" variation 64 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="g" /db_xref="dbSNP:1856748084" variation 66 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:368138070" variation 67 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:765600576" variation 71..73 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="cc" /replace="ccc" /db_xref="dbSNP:2495684114" variation 71 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1238221464" variation 73 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:1856748238" variation 74 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:931547376" variation 80..84 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="gc" /replace="gcagc" /db_xref="dbSNP:1183424630" variation 83 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="g" /replace="t" /db_xref="dbSNP:2495684119" variation 84 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="c" /replace="t" /db_xref="dbSNP:753138876" variation 86 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1460912837" variation 87 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:1159734130" variation 92..93 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="" /replace="ct" /db_xref="dbSNP:2495684133" variation 93..94 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="" /replace="cc" /db_xref="dbSNP:2495684138" variation 93 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="g" /db_xref="dbSNP:758938351" variation 94..95 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="" /replace="tgtc" /db_xref="dbSNP:2495684140" variation 95 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:778486713" variation 98 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /replace="t" /db_xref="dbSNP:1856748504" variation 99 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /db_xref="dbSNP:2495684171" variation 100 /gene="MIR612" /gene_synonym="hsa-mir-612; MIRN612" /replace="a" /replace="c" /db_xref="dbSNP:2495684176" ORIGIN
tcccatctggaccctgctgggcagggcttctgagctccttagcactagcaggaggggctccaggggccctccctccatggcagccaggacaggactctca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]