GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:56:56, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_030343                100 bp    RNA     linear   PRI 13-JAN-2020
DEFINITION  Homo sapiens microRNA 612 (MIR612), microRNA.
ACCESSION   NR_030343
VERSION     NR_030343.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 100)
  AUTHORS   Wang M, Wang Z, Zhu X, Guan S and Liu Z.
  TITLE     NFKB1-miR-612-FAIM2 pathway regulates tumorigenesis in
            neurofibromatosis type 1
  JOURNAL   In Vitro Cell. Dev. Biol. Anim. 55 (7), 491-500 (2019)
   PUBMED   31197610
  REMARK    GeneRIF: The current investigation uncovered the molecular
            mechanism underlying miR-612 in Neurofibromatosis type I,
            establishing miR-612 as a novel therapeutic target for the
            treatment of Neurofibromatosis type I patients.
REFERENCE   2  (bases 1 to 100)
  AUTHORS   Garcia-Lacarte M, Martinez JA, Zulet MA and Milagro FI.
  TITLE     Implication of miR-612 and miR-1976 in the regulation of TP53 and
            CD40 and their relationship in the response to specific weight-loss
            diets
  JOURNAL   PLoS ONE 13 (8), e0201217 (2018)
   PUBMED   30089130
  REMARK    GeneRIF: The bioinformatic prediction revealed that TP53 was a
            putative target gene of miR-612 and CD40 of miR-1976. Moreover,
            TP53 was downregulated in the expression array when comparing HR vs
            LR expression levels adjusted by sex, diet, age and baseline
            weight, and CD40 showed a statistical trend.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 100)
  AUTHORS   Liu M, Chen Y, Huang B, Mao S, Cai K, Wang L and Yao X.
  TITLE     Tumor-suppressing effects of microRNA-612 in bladder cancer cells
            by targeting malic enzyme 1 expression
  JOURNAL   Int. J. Oncol. 52 (6), 1923-1933 (2018)
   PUBMED   29620192
  REMARK    GeneRIF: Results provided evidence indicating that miR612
            expression is downregulated in bladder cancer tissues and cell
            lines, and that decreased miR612 expression is associated with
            advanced bladder cancer TNM stages and distant metastasis. further
            suggested that miR612 expression was able to inhibit bladder cancer
            cell growth, colony formation, migration, invasion and EMT through
            directly targeting the expression of ME1.
REFERENCE   4  (bases 1 to 100)
  AUTHORS   Zhu Y, Zhang HL, Wang QY, Chen MJ and Liu LB.
  TITLE     Overexpression of microRNA-612 Restrains the Growth, Invasion, and
            Tumorigenesis of Melanoma Cells by Targeting Espin
  JOURNAL   Mol. Cells 41 (2), 119-126 (2018)
   PUBMED   29385671
  REMARK    GeneRIF: significant inverse correlation was observed between
            miR-612 and Espin protein expression in melanoma tissues.
REFERENCE   5  (bases 1 to 100)
  AUTHORS   Zhou P, Dong H, He S, Fang L, Jiang N and Sun Q.
  TITLE     miR612 is associated with esophageal squamous cell carcinoma
            development and metastasis, mediated through TP53
  JOURNAL   Mol Med Rep 16 (2), 1855-1863 (2017)
   PUBMED   28656264
  REMARK    GeneRIF: miR612 is identified as associated with esophageal
            squamous cell carcinoma development and metastasis, likely through
            the regulation of TP53 expression.
REFERENCE   6  (bases 1 to 100)
  AUTHORS   Gutierrez-Camino A, Lopez-Lopez E, Martin-Guerrero I, Pinan MA,
            Garcia-Miguel P, Sanchez-Toledo J, Carbone Baneres A, Uriz J,
            Navajas A and Garcia-Orad A.
  TITLE     Noncoding RNA-related polymorphisms in pediatric acute
            lymphoblastic leukemia susceptibility
  JOURNAL   Pediatr. Res. 75 (6), 767-773 (2014)
   PUBMED   24618566
  REMARK    GeneRIF: rs12803915 in mir-612 exhibited a significant association
            with pediatric acute lymphoblastic leukemia.
REFERENCE   7  (bases 1 to 100)
  AUTHORS   Tao ZH, Wan JL, Zeng LY, Xie L, Sun HC, Qin LX, Wang L, Zhou J, Ren
            ZG, Li YX, Fan J and Wu WZ.
  TITLE     miR-612 suppresses the invasive-metastatic cascade in
            hepatocellular carcinoma
  JOURNAL   J. Exp. Med. 210 (4), 789-803 (2013)
   PUBMED   23478189
  REMARK    GeneRIF: miR-612 is involved in both the initial and final steps of
            the metastatic cascade, by suppressing local invasion and distant
            colonization.
REFERENCE   8  (bases 1 to 100)
  AUTHORS   Kim HK, Prokunina-Olsson L and Chanock SJ.
  TITLE     Common genetic variants in miR-1206 (8q24.2) and miR-612 (11q13.3)
            affect biogenesis of mature miRNA forms
  JOURNAL   PLoS ONE 7 (10), e47454 (2012)
   PUBMED   23077621
  REMARK    GeneRIF: The two SNPs within miR-612 significantly affected
            expression of mature miR-612 in a cell-type specific manner;
            enhancement in prostate cancer cell lines, reduction in colon
            cancer cells, and no effect in breast cancer cell lines.
REFERENCE   9  (bases 1 to 100)
  AUTHORS   Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T,
            Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK,
            Roberts BS, Juhl H, Kinzler KW, Vogelstein B and Velculescu VE.
  TITLE     The colorectal microRNAome
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 103 (10), 3687-3692 (2006)
   PUBMED   16505370
REFERENCE   10 (bases 1 to 100)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AP000769.5.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-100               AP000769.5         10332-10431
FEATURES             Location/Qualifiers
     source          1..100
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q13.1"
     gene            1..100
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /note="microRNA 612"
                     /db_xref="GeneID:693197"
                     /db_xref="HGNC:HGNC:32868"
                     /db_xref="miRBase:MI0003625"
     precursor_RNA   1..100
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /product="microRNA 612"
                     /db_xref="GeneID:693197"
                     /db_xref="HGNC:HGNC:32868"
                     /db_xref="miRBase:MI0003625"
     exon            1..100
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771270853"
     variation       5
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776967411"
     variation       6
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906784255"
     variation       9
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249942741"
     variation       12
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:550894"
     ncRNA           16..40
                     /ncRNA_class="miRNA"
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /product="hsa-miR-612"
                     /db_xref="miRBase:MIMAT0003280"
                     /db_xref="GeneID:693197"
                     /db_xref="HGNC:HGNC:32868"
                     /db_xref="miRBase:MI0003625"
     variation       21
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168134916"
     variation       24
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337907735"
     variation       34
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418535165"
     variation       35
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405700548"
     variation       36
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768430062"
     variation       37
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774044559"
     variation       40
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405130248"
     variation       41
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460832875"
     variation       42
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761689908"
     variation       43
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320726555"
     variation       48
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366719792"
     variation       51
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12803915"
     variation       53
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772678689"
     variation       54
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760246850"
     variation       56
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765936428"
     variation       58..77
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="ctcca"
                     /replace="ctccaggggccctccctcca"
                     /db_xref="dbSNP:1288140234"
     variation       60
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753475143"
     variation       61
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209901430"
     variation       62
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270109511"
     variation       66
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368138070"
     variation       67
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765600576"
     variation       71
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238221464"
     variation       74
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931547376"
     variation       80..84
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="gc"
                     /replace="gcagc"
                     /db_xref="dbSNP:1183424630"
     variation       84
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753138876"
     variation       86
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460912837"
     variation       87
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159734130"
     variation       93
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758938351"
     variation       95
                     /gene="MIR612"
                     /gene_synonym="hsa-mir-612; MIRN612"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778486713"
ORIGIN      
tcccatctggaccctgctgggcagggcttctgagctccttagcactagcaggaggggctccaggggccctccctccatggcagccaggacaggactctca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]