ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-21 07:43:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_030343 100 bp RNA linear PRI 20-JUN-2024
DEFINITION Homo sapiens microRNA 612 (MIR612), microRNA.
ACCESSION NR_030343
VERSION NR_030343.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 100)
AUTHORS Zhao,Y., Xu,L., Wang,Q., Li,C., Zhang,T., Xing,S. and Yu,X.
TITLE LINC01061 triggers inflammation and inflammasome activation in
autoimmune thyroiditis via microRNA-612/BRD4 axis
JOURNAL Int Immunopharmacol 111, 109050 (2022)
PUBMED 35998503
REMARK GeneRIF: LINC01061 triggers inflammation and inflammasome
activation in autoimmune thyroiditis via microRNA-612/BRD4 axis.
REFERENCE 2 (bases 1 to 100)
AUTHORS Ayon-Perez,M.F., Gomez-Gomez,Y., Organista-Nava,J.,
Leyva-Vazquez,M.A., Zambrano-Zaragoza,J.F., Reyes-Fregoso,J.C.,
Agraz-Cibrian,J.M., Gutierrez-Franco,J., Victorio-De Los Santos,M.
and Vazquez-Reyes,A.
TITLE Association of MIR3117 and MIR612 Genes Polymorphisms with
Childhood Acute Lymphoblastic Leukemia in the Mexican Population
JOURNAL Arch Med Res 53 (6), 603-609 (2022)
PUBMED 36002354
REMARK GeneRIF: Association of MIR3117 and MIR612 Genes Polymorphisms with
Childhood Acute Lymphoblastic Leukemia in the Mexican Population.
REFERENCE 3 (bases 1 to 100)
AUTHORS Ge,L., Xun,C., Li,W., Jin,S., Liu,Z., Zhuo,Y., Duan,D., Hu,Z.,
Chen,P. and Lu,M.
TITLE Extracellular vesicles derived from hypoxia-preconditioned
olfactory mucosa mesenchymal stem cells enhance angiogenesis via
miR-612
JOURNAL J Nanobiotechnology 19 (1), 380 (2021)
PUBMED 34802444
REMARK GeneRIF: Extracellular vesicles derived from hypoxia-preconditioned
olfactory mucosa mesenchymal stem cells enhance angiogenesis via
miR-612.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 100)
AUTHORS Li,J., Huang,S., Zhang,Y., Zhuo,W., Tong,B. and Cai,F.
TITLE LINC00460 Enhances Bladder Carcinoma Cell Proliferation and
Migration by Modulating miR-612/FOXK1 Axis
JOURNAL Pharmacology 106 (1-2), 79-90 (2021)
PUBMED 33027786
REMARK GeneRIF: LINC00460 Enhances Bladder Carcinoma Cell Proliferation
and Migration by Modulating miR-612/FOXK1 Axis.
REFERENCE 5 (bases 1 to 100)
AUTHORS Liu,Y., Lu,L.L., Wen,D., Liu,D.L., Dong,L.L., Gao,D.M., Bian,X.Y.,
Zhou,J., Fan,J. and Wu,W.Z.
TITLE MiR-612 regulates invadopodia of hepatocellular carcinoma by
HADHA-mediated lipid reprogramming
JOURNAL J Hematol Oncol 13 (1), 12 (2020)
PUBMED 32033570
REMARK GeneRIF: MiR-612 regulates invadopodia of hepatocellular carcinoma
by HADHA-mediated lipid reprogramming.
Erratum:[J Hematol Oncol. 2020 May 4;13(1):44. doi:
10.1186/s13045-020-00875-5. PMID: 32366313]
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 100)
AUTHORS Gutierrez-Camino,A., Lopez-Lopez,E., Martin-Guerrero,I.,
Pinan,M.A., Garcia-Miguel,P., Sanchez-Toledo,J., Carbone
Baneres,A., Uriz,J., Navajas,A. and Garcia-Orad,A.
TITLE Noncoding RNA-related polymorphisms in pediatric acute
lymphoblastic leukemia susceptibility
JOURNAL Pediatr Res 75 (6), 767-773 (2014)
PUBMED 24618566
REMARK GeneRIF: rs12803915 in mir-612 exhibited a significant association
with pediatric acute lymphoblastic leukemia.
REFERENCE 7 (bases 1 to 100)
AUTHORS Tao,Z.H., Wan,J.L., Zeng,L.Y., Xie,L., Sun,H.C., Qin,L.X., Wang,L.,
Zhou,J., Ren,Z.G., Li,Y.X., Fan,J. and Wu,W.Z.
TITLE miR-612 suppresses the invasive-metastatic cascade in
hepatocellular carcinoma
JOURNAL J Exp Med 210 (4), 789-803 (2013)
PUBMED 23478189
REMARK GeneRIF: miR-612 is involved in both the initial and final steps of
the metastatic cascade, by suppressing local invasion and distant
colonization.
REFERENCE 8 (bases 1 to 100)
AUTHORS Kim,H.K., Prokunina-Olsson,L. and Chanock,S.J.
TITLE Common genetic variants in miR-1206 (8q24.2) and miR-612 (11q13.3)
affect biogenesis of mature miRNA forms
JOURNAL PLoS One 7 (10), e47454 (2012)
PUBMED 23077621
REMARK GeneRIF: The two SNPs within miR-612 significantly affected
expression of mature miR-612 in a cell-type specific manner;
enhancement in prostate cancer cell lines, reduction in colon
cancer cells, and no effect in breast cancer cell lines.
REFERENCE 9 (bases 1 to 100)
AUTHORS Cummins,J.M., He,Y., Leary,R.J., Pagliarini,R., Diaz,L.A. Jr.,
Sjoblom,T., Barad,O., Bentwich,Z., Szafranska,A.E., Labourier,E.,
Raymond,C.K., Roberts,B.S., Juhl,H., Kinzler,K.W., Vogelstein,B.
and Velculescu,V.E.
TITLE The colorectal microRNAome
JOURNAL Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006)
PUBMED 16505370
REFERENCE 10 (bases 1 to 100)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AP000769.5.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-100 AP000769.5 10332-10431
FEATURES Location/Qualifiers
source 1..100
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q13.1"
gene 1..100
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/note="microRNA 612"
/db_xref="GeneID:693197"
/db_xref="HGNC:HGNC:32868"
/db_xref="miRBase:MI0003625"
precursor_RNA 1..100
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/product="microRNA 612"
/db_xref="GeneID:693197"
/db_xref="HGNC:HGNC:32868"
/db_xref="miRBase:MI0003625"
exon 1..100
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:1856747208"
variation 2
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:771270853"
variation 5
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:776967411"
variation 6
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:906784255"
variation 9
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="g"
/replace="t"
/db_xref="dbSNP:1249942741"
variation 12
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/db_xref="dbSNP:550894"
variation 15
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace=""
/replace="t"
/db_xref="dbSNP:2495683947"
ncRNA 16..40
/ncRNA_class="miRNA"
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/product="hsa-miR-612"
/db_xref="miRBase:MIMAT0003280"
/db_xref="GeneID:693197"
/db_xref="HGNC:HGNC:32868"
/db_xref="miRBase:MI0003625"
variation 20
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:2134911302"
variation 21
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:1168134916"
variation 23
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:2495683967"
variation 24
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="g"
/db_xref="dbSNP:1337907735"
variation 34
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:1418535165"
variation 35
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:1405700548"
variation 36
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:768430062"
variation 37
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/db_xref="dbSNP:774044559"
variation 39
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:2495683994"
variation 40
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:1405130248"
variation 41
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:1460832875"
variation 42
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:761689908"
variation 43
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/db_xref="dbSNP:1320726555"
variation 45
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1856747655"
variation 48
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1366719792"
variation 50
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:1856747707"
variation 51
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:12803915"
variation 53
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="t"
/db_xref="dbSNP:772678689"
variation 54..57
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="ggg"
/replace="gggg"
/db_xref="dbSNP:2495684068"
variation 54
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:760246850"
variation 56
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:765936428"
variation 57
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:2495684075"
variation 58..77
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="ctcca"
/replace="ctccaggggccctccctcca"
/db_xref="dbSNP:1288140234"
variation 60
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:753475143"
variation 61
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1209901430"
variation 62
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:1270109511"
variation 64
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="g"
/db_xref="dbSNP:1856748084"
variation 66
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:368138070"
variation 67
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:765600576"
variation 71..73
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:2495684114"
variation 71
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1238221464"
variation 73
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1856748238"
variation 74
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:931547376"
variation 80..84
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="gc"
/replace="gcagc"
/db_xref="dbSNP:1183424630"
variation 83
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="g"
/replace="t"
/db_xref="dbSNP:2495684119"
variation 84
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="c"
/replace="t"
/db_xref="dbSNP:753138876"
variation 86
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1460912837"
variation 87
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1159734130"
variation 92..93
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace=""
/replace="ct"
/db_xref="dbSNP:2495684133"
variation 93..94
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace=""
/replace="cc"
/db_xref="dbSNP:2495684138"
variation 93
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="g"
/db_xref="dbSNP:758938351"
variation 94..95
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace=""
/replace="tgtc"
/db_xref="dbSNP:2495684140"
variation 95
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:778486713"
variation 98
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1856748504"
variation 99
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/db_xref="dbSNP:2495684171"
variation 100
/gene="MIR612"
/gene_synonym="hsa-mir-612; MIRN612"
/replace="a"
/replace="c"
/db_xref="dbSNP:2495684176"
ORIGIN
tcccatctggaccctgctgggcagggcttctgagctccttagcactagcaggaggggctccaggggccctccctccatggcagccaggacaggactctca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]