LOCUS       NR_030133                 83 bp    RNA     linear   VRT 02-JAN-2023
DEFINITION  Danio rerio microRNA 375-2 (dre-mir-375-2), microRNA.
ACCESSION   NR_030133
VERSION     NR_030133.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 83)
  AUTHORS   Zhang X, Li Y, Zhang Y and Li S.
  TITLE     Characterization of small RNAs in early zebrafish PGCs
  JOURNAL   Acta Biochim Biophys Sin (Shanghai) 53 (4), 514-516 (2021)
   PUBMED   33506864
REFERENCE   2  (bases 1 to 83)
  AUTHORS   Martin L, Kamstra JH, Hurem S, Lindeman LC, Brede DA, Aanes H,
            Babiak I, Arenal A, Oughton D, Salbu B, Lyche JL and Alestrom P.
  TITLE     Altered non-coding RNA expression profile in F1 progeny 1 year
            after parental irradiation is linked to adverse effects in
            zebrafish
  JOURNAL   Sci Rep 11 (1), 4142 (2021)
   PUBMED   33602989
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 83)
  AUTHORS   Tu W, Martinez R, Navarro-Martin L, Kostyniuk DJ, Hum C, Huang J,
            Deng M, Jin Y, Chan HM and Mennigen JA.
  TITLE     Bioconcentration and Metabolic Effects of Emerging PFOS
            Alternatives in Developing Zebrafish
  JOURNAL   Environ Sci Technol 53 (22), 13427-13439 (2019)
   PUBMED   31609598
REFERENCE   4  (bases 1 to 83)
  AUTHORS   Desvignes T, Batzel P, Sydes J, Eames BF and Postlethwait JH.
  TITLE     miRNA analysis with Prost! reveals evolutionary conservation of
            organ-enriched expression and post-transcriptional modifications in
            three-spined stickleback and zebrafish
  JOURNAL   Sci Rep 9 (1), 3913 (2019)
   PUBMED   30850632
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 83)
  AUTHORS   King BL and Yin VP.
  TITLE     A Conserved MicroRNA Regulatory Circuit Is Differentially
            Controlled during Limb/Appendage Regeneration
  JOURNAL   PLoS One 11 (6), e0157106 (2016)
   PUBMED   27355827
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 83)
  AUTHORS   Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD and Plasterk
            RH.
  TITLE     Targeted inhibition of miRNA maturation with morpholinos reveals a
            role for miR-375 in pancreatic islet development
  JOURNAL   PLoS Biol 5 (8), e203 (2007)
   PUBMED   17676975
REFERENCE   7  (bases 1 to 83)
  AUTHORS   Kapsimali M, Kloosterman WP, de Bruijn E, Rosa F, Plasterk RH and
            Wilson SW.
  TITLE     MicroRNAs show a wide diversity of expression profiles in the
            developing and mature central nervous system
  JOURNAL   Genome Biol 8 (8), R173 (2007)
   PUBMED   17711588
REFERENCE   8  (bases 1 to 83)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 83)
  AUTHORS   Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan
            R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M and Tuschl T.
  TITLE     The developmental miRNA profiles of zebrafish as determined by
            small RNA cloning
  JOURNAL   Genes Dev 19 (11), 1288-1293 (2005)
   PUBMED   15937218
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from CU468956.14.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609239.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-83                CU468956.14        114084-114166
FEATURES             Location/Qualifiers
     source          1..83
                     /organism="Danio rerio"
                     /mol_type="transcribed RNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="9"
                     /map="9"
     gene            1..83
                     /gene="dre-mir-375-2"
                     /gene_synonym="mir375-2"
                     /note="microRNA 375-2"
                     /db_xref="GeneID:100033789"
                     /db_xref="miRBase:MI0002073"
                     /db_xref="ZFIN:ZDB-MIRNAG-071107-2"
     precursor_RNA   1..83
                     /gene="dre-mir-375-2"
                     /gene_synonym="mir375-2"
                     /product="microRNA 375-2"
                     /db_xref="GeneID:100033789"
                     /db_xref="miRBase:MI0002073"
                     /db_xref="ZFIN:ZDB-MIRNAG-071107-2"
     exon            1..83
                     /gene="dre-mir-375-2"
                     /gene_synonym="mir375-2"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           52..73
                     /ncRNA_class="miRNA"
                     /gene="dre-mir-375-2"
                     /gene_synonym="mir375-2"
                     /product="dre-miR-375"
                     /db_xref="miRBase:MIMAT0001876"
                     /db_xref="GeneID:100033789"
                     /db_xref="miRBase:MI0002073"
                     /db_xref="ZFIN:ZDB-MIRNAG-071107-2"
ORIGIN      

tgtacttgtctcacgttgagccacacgcacaatgcctgcagatgaaagggttttgttcgttcggctcgcgttacgcagatgca

//