2025-07-12 15:58:57, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_030133 83 bp RNA linear VRT 02-JAN-2023 DEFINITION Danio rerio microRNA 375-2 (dre-mir-375-2), microRNA. ACCESSION NR_030133 VERSION NR_030133.1 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 83) AUTHORS Zhang X, Li Y, Zhang Y and Li S. TITLE Characterization of small RNAs in early zebrafish PGCs JOURNAL Acta Biochim Biophys Sin (Shanghai) 53 (4), 514-516 (2021) PUBMED 33506864 REFERENCE 2 (bases 1 to 83) AUTHORS Martin L, Kamstra JH, Hurem S, Lindeman LC, Brede DA, Aanes H, Babiak I, Arenal A, Oughton D, Salbu B, Lyche JL and Alestrom P. TITLE Altered non-coding RNA expression profile in F1 progeny 1 year after parental irradiation is linked to adverse effects in zebrafish JOURNAL Sci Rep 11 (1), 4142 (2021) PUBMED 33602989 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 83) AUTHORS Tu W, Martinez R, Navarro-Martin L, Kostyniuk DJ, Hum C, Huang J, Deng M, Jin Y, Chan HM and Mennigen JA. TITLE Bioconcentration and Metabolic Effects of Emerging PFOS Alternatives in Developing Zebrafish JOURNAL Environ Sci Technol 53 (22), 13427-13439 (2019) PUBMED 31609598 REFERENCE 4 (bases 1 to 83) AUTHORS Desvignes T, Batzel P, Sydes J, Eames BF and Postlethwait JH. TITLE miRNA analysis with Prost! reveals evolutionary conservation of organ-enriched expression and post-transcriptional modifications in three-spined stickleback and zebrafish JOURNAL Sci Rep 9 (1), 3913 (2019) PUBMED 30850632 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 83) AUTHORS King BL and Yin VP. TITLE A Conserved MicroRNA Regulatory Circuit Is Differentially Controlled during Limb/Appendage Regeneration JOURNAL PLoS One 11 (6), e0157106 (2016) PUBMED 27355827 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 83) AUTHORS Kloosterman WP, Lagendijk AK, Ketting RF, Moulton JD and Plasterk RH. TITLE Targeted inhibition of miRNA maturation with morpholinos reveals a role for miR-375 in pancreatic islet development JOURNAL PLoS Biol 5 (8), e203 (2007) PUBMED 17676975 REFERENCE 7 (bases 1 to 83) AUTHORS Kapsimali M, Kloosterman WP, de Bruijn E, Rosa F, Plasterk RH and Wilson SW. TITLE MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system JOURNAL Genome Biol 8 (8), R173 (2007) PUBMED 17711588 REFERENCE 8 (bases 1 to 83) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 REFERENCE 9 (bases 1 to 83) AUTHORS Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M and Tuschl T. TITLE The developmental miRNA profiles of zebrafish as determined by small RNA cloning JOURNAL Genes Dev 19 (11), 1288-1293 (2005) PUBMED 15937218 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from CU468956.14. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. ##Evidence-Data-START## Transcript is intronless :: LM609239.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-83 CU468956.14 114084-114166 FEATURES Location/Qualifiers source 1..83 /organism="Danio rerio" /mol_type="transcribed RNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="9" /map="9" gene 1..83 /gene="dre-mir-375-2" /gene_synonym="mir375-2" /note="microRNA 375-2" /db_xref="GeneID:100033789" /db_xref="miRBase:MI0002073" /db_xref="ZFIN:ZDB-MIRNAG-071107-2" precursor_RNA 1..83 /gene="dre-mir-375-2" /gene_synonym="mir375-2" /product="microRNA 375-2" /db_xref="GeneID:100033789" /db_xref="miRBase:MI0002073" /db_xref="ZFIN:ZDB-MIRNAG-071107-2" exon 1..83 /gene="dre-mir-375-2" /gene_synonym="mir375-2" /inference="alignment:Splign:2.1.0" ncRNA 52..73 /ncRNA_class="miRNA" /gene="dre-mir-375-2" /gene_synonym="mir375-2" /product="dre-miR-375" /db_xref="miRBase:MIMAT0001876" /db_xref="GeneID:100033789" /db_xref="miRBase:MI0002073" /db_xref="ZFIN:ZDB-MIRNAG-071107-2" ORIGIN
tgtacttgtctcacgttgagccacacgcacaatgcctgcagatgaaagggttttgttcgttcggctcgcgttacgcagatgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]