ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-27 06:53:50, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_030133 83 bp RNA linear VRT 05-JUN-2025
DEFINITION Danio rerio microRNA 375-2 (dre-mir-375-2), microRNA.
ACCESSION NR_030133
VERSION NR_030133.1
KEYWORDS RefSeq.
SOURCE Danio rerio (zebrafish)
ORGANISM Danio rerio
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE 1 (bases 1 to 83)
AUTHORS Zhang,X., Li,Y., Zhang,Y. and Li,S.
TITLE Characterization of small RNAs in early zebrafish PGCs
JOURNAL Acta Biochim Biophys Sin (Shanghai) 53 (4), 514-516 (2021)
PUBMED 33506864
REFERENCE 2 (bases 1 to 83)
AUTHORS Martin,L., Kamstra,J.H., Hurem,S., Lindeman,L.C., Brede,D.A.,
Aanes,H., Babiak,I., Arenal,A., Oughton,D., Salbu,B., Lyche,J.L.
and Alestrom,P.
TITLE Altered non-coding RNA expression profile in F1 progeny 1 year
after parental irradiation is linked to adverse effects in
zebrafish
JOURNAL Sci Rep 11 (1), 4142 (2021)
PUBMED 33602989
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 83)
AUTHORS Tu,W., Martinez,R., Navarro-Martin,L., Kostyniuk,D.J., Hum,C.,
Huang,J., Deng,M., Jin,Y., Chan,H.M. and Mennigen,J.A.
TITLE Bioconcentration and Metabolic Effects of Emerging PFOS
Alternatives in Developing Zebrafish
JOURNAL Environ Sci Technol 53 (22), 13427-13439 (2019)
PUBMED 31609598
REFERENCE 4 (bases 1 to 83)
AUTHORS Desvignes,T., Batzel,P., Sydes,J., Eames,B.F. and Postlethwait,J.H.
TITLE miRNA analysis with Prost! reveals evolutionary conservation of
organ-enriched expression and post-transcriptional modifications in
three-spined stickleback and zebrafish
JOURNAL Sci Rep 9 (1), 3913 (2019)
PUBMED 30850632
REMARK Publication Status: Online-Only
REFERENCE 5 (bases 1 to 83)
AUTHORS King,B.L. and Yin,V.P.
TITLE A Conserved MicroRNA Regulatory Circuit Is Differentially
Controlled during Limb/Appendage Regeneration
JOURNAL PLoS One 11 (6), e0157106 (2016)
PUBMED 27355827
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 83)
AUTHORS Kloosterman,W.P., Lagendijk,A.K., Ketting,R.F., Moulton,J.D. and
Plasterk,R.H.
TITLE Targeted inhibition of miRNA maturation with morpholinos reveals a
role for miR-375 in pancreatic islet development
JOURNAL PLoS Biol 5 (8), e203 (2007)
PUBMED 17676975
REFERENCE 7 (bases 1 to 83)
AUTHORS Kapsimali,M., Kloosterman,W.P., de Bruijn,E., Rosa,F.,
Plasterk,R.H. and Wilson,S.W.
TITLE MicroRNAs show a wide diversity of expression profiles in the
developing and mature central nervous system
JOURNAL Genome Biol 8 (8), R173 (2007)
PUBMED 17711588
REFERENCE 8 (bases 1 to 83)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
REFERENCE 9 (bases 1 to 83)
AUTHORS Chen,P.Y., Manninga,H., Slanchev,K., Chien,M., Russo,J.J., Ju,J.,
Sheridan,R., John,B., Marks,D.S., Gaidatzis,D., Sander,C.,
Zavolan,M. and Tuschl,T.
TITLE The developmental miRNA profiles of zebrafish as determined by
small RNA cloning
JOURNAL Genes Dev 19 (11), 1288-1293 (2005)
PUBMED 15937218
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from JBMGRA010000009.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: LM609239.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-83 JBMGRA010000009.1 11691460-11691542 c
FEATURES Location/Qualifiers
source 1..83
/organism="Danio rerio"
/mol_type="transcribed RNA"
/strain="Tuebingen"
/db_xref="taxon:7955"
/chromosome="9"
/map="9"
gene 1..83
/gene="dre-mir-375-2"
/gene_synonym="mir375-2"
/note="microRNA 375-2"
/db_xref="GeneID:100033789"
/db_xref="miRBase:MI0002073"
/db_xref="ZFIN:ZDB-MIRNAG-071107-2"
precursor_RNA 1..83
/gene="dre-mir-375-2"
/gene_synonym="mir375-2"
/product="microRNA 375-2"
/db_xref="GeneID:100033789"
/db_xref="miRBase:MI0002073"
/db_xref="ZFIN:ZDB-MIRNAG-071107-2"
exon 1..83
/gene="dre-mir-375-2"
/gene_synonym="mir375-2"
/inference="alignment:Splign:2.1.0"
ncRNA 52..73
/ncRNA_class="miRNA"
/gene="dre-mir-375-2"
/gene_synonym="mir375-2"
/product="dre-miR-375"
/db_xref="miRBase:MIMAT0001876"
/db_xref="GeneID:100033789"
/db_xref="miRBase:MI0002073"
/db_xref="ZFIN:ZDB-MIRNAG-071107-2"
ORIGIN
tgtacttgtctcacgttgagccacacgcacaatgcctgcagatgaaagggttttgttcgttcggctcgcgttacgcagatgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]