LOCUS       NR_029876                 64 bp    RNA     linear   ROD 08-NOV-2023
DEFINITION  Mus musculus microRNA 375 (Mir375), microRNA.
ACCESSION   NR_029876
VERSION     NR_029876.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 64)
  AUTHORS   Hung YH, Capeling M, Villanueva JW, Kanke M, Shanahan MT, Huang S,
            Cubitt R, Rinaldi VD, Schimenti JC, Spence JR and Sethupathy P.
  TITLE     Integrative genome-scale analyses reveal post-transcriptional
            signatures of early human small intestinal development in a
            directed differentiation organoid model
  JOURNAL   BMC Genomics 24 (1), 641 (2023)
   PUBMED   37884859
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 64)
  AUTHORS   Chen J, Lai K, Yong X, Yin H, Chen Z, Wang H, Chen K and Zheng J.
  TITLE     Silencing METTL3 Stabilizes Atherosclerotic Plaques by Regulating
            the Phenotypic Transformation of Vascular Smooth Muscle Cells via
            the miR-375-3p/PDK1 Axis
  JOURNAL   Cardiovasc Drugs Ther 37 (3), 471-486 (2023)
   PUBMED   35704246
  REMARK    GeneRIF: Silencing METTL3 Stabilizes Atherosclerotic Plaques by
            Regulating the Phenotypic Transformation of Vascular Smooth Muscle
            Cells via the miR-375-3p/PDK1 Axis.
REFERENCE   3  (bases 1 to 64)
  AUTHORS   McCoy MG, Jamaiyar A, Sausen G, Cheng HS, Perez-Cremades D, Zhuang
            R, Chen J, Goodney PP, Creager MA, Sabatine MS, Bonaca MP and
            Feinberg MW.
  TITLE     MicroRNA-375 repression of Kruppel-like factor 5 improves
            angiogenesis in diabetic critical limb ischemia
  JOURNAL   Angiogenesis 26 (1), 107-127 (2023)
   PUBMED   36074222
  REMARK    GeneRIF: MicroRNA-375 repression of Kruppel-like factor 5 improves
            angiogenesis in diabetic critical limb ischemia.
REFERENCE   4  (bases 1 to 64)
  AUTHORS   Lin X, Cheng L, Wan Y, Yan Y, Zhang Z, Li X, Wu J, Wang X and Xu M.
  TITLE     Ang II Controls the Expression of Mapkap1 by miR-375 and Affects
            the Function of Islet beta Cells
  JOURNAL   Endocr Metab Immune Disord Drug Targets 23 (9), 1186-1200 (2023)
   PUBMED   36748222
  REMARK    GeneRIF: Ang II Controls the Expression of Mapkap1 by miR-375 and
            Affects the Function of Islet beta Cells.
REFERENCE   5  (bases 1 to 64)
  AUTHORS   Gong R, Han R, Zhuang X, Tang W, Xu G, Zhang L, Wu J and Ma J.
  TITLE     MiR-375 mitigates retinal angiogenesis by depressing the JAK2/STAT3
            pathway
  JOURNAL   Aging (Albany NY) 14 (16), 6594-6604 (2022)
   PUBMED   35980290
  REMARK    GeneRIF: MiR-375 mitigates retinal angiogenesis by depressing the
            JAK2/STAT3 pathway.
REFERENCE   6  (bases 1 to 64)
  AUTHORS   Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
            Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
            Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
            Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
            M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
            V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
            Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
            Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
            Zavolan M and Tuschl T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   7  (bases 1 to 64)
  AUTHORS   Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, Lee C,
            Tarakhovsky A, Lao K and Surani MA.
  TITLE     Maternal microRNAs are essential for mouse zygotic development
  JOURNAL   Genes Dev 21 (6), 644-648 (2007)
   PUBMED   17369397
REFERENCE   8  (bases 1 to 64)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 64)
  AUTHORS   Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin
            P, da Piedade I, Gunsalus KC, Stoffel M and Rajewsky N.
  TITLE     Combinatorial microRNA target predictions
  JOURNAL   Nat Genet 37 (5), 495-500 (2005)
   PUBMED   15806104
REFERENCE   10 (bases 1 to 64)
  AUTHORS   Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE,
            Pfeffer S, Tuschl T, Rajewsky N, Rorsman P and Stoffel M.
  TITLE     A pancreatic islet-specific microRNA regulates insulin secretion
  JOURNAL   Nature 432 (7014), 226-230 (2004)
   PUBMED   15538371
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC139023.15.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM608710.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-64                AC139023.15        91957-92020         c
FEATURES             Location/Qualifiers
     source          1..64
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="1"
                     /map="1 38.54 cM"
     gene            1..64
                     /gene="Mir375"
                     /gene_synonym="mir-375; Mirn375; mmu-mir-375"
                     /note="microRNA 375"
                     /db_xref="GeneID:723900"
                     /db_xref="MGI:MGI:3619376"
                     /db_xref="miRBase:MI0000792"
     precursor_RNA   1..64
                     /gene="Mir375"
                     /gene_synonym="mir-375; Mirn375; mmu-mir-375"
                     /product="microRNA 375"
                     /db_xref="GeneID:723900"
                     /db_xref="MGI:MGI:3619376"
                     /db_xref="miRBase:MI0000792"
     exon            1..64
                     /gene="Mir375"
                     /gene_synonym="mir-375; Mirn375; mmu-mir-375"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           5..26
                     /ncRNA_class="miRNA"
                     /gene="Mir375"
                     /gene_synonym="mir-375; Mirn375; mmu-mir-375"
                     /product="mmu-miR-375-5p"
                     /db_xref="miRBase:MIMAT0017078"
                     /db_xref="GeneID:723900"
                     /db_xref="MGI:MGI:3619376"
                     /db_xref="miRBase:MI0000792"
     ncRNA           40..61
                     /ncRNA_class="miRNA"
                     /gene="Mir375"
                     /gene_synonym="mir-375; Mirn375; mmu-mir-375"
                     /product="mmu-miR-375-3p"
                     /db_xref="miRBase:MIMAT0000739"
                     /db_xref="GeneID:723900"
                     /db_xref="MGI:MGI:3619376"
                     /db_xref="miRBase:MI0000792"
ORIGIN      

ccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggc

//