LOCUS       NR_029867                 64 bp    RNA     linear   PRI 25-DEC-2023
DEFINITION  Homo sapiens microRNA 375 (MIR375), microRNA.
ACCESSION   NR_029867
VERSION     NR_029867.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 64)
  AUTHORS   Chen X, Sokirniy I, Wang X, Jiang M, Mseis-Jackson N, Williams C,
            Mayes K, Jiang N, Puls B, Du Q, Shi Y and Li H.
  TITLE     MicroRNA-375 Is Induced during Astrocyte-to-Neuron Reprogramming
            and Promotes Survival of Reprogrammed Neurons when Overexpressed
  JOURNAL   Cells 12 (17), 2202 (2023)
   PUBMED   37681934
  REMARK    GeneRIF: MicroRNA-375 Is Induced during Astrocyte-to-Neuron
            Reprogramming and Promotes Survival of Reprogrammed Neurons when
            Overexpressed.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 64)
  AUTHORS   Du S, Qu H, Zhang Y, Zhu S, Wang Y, Zhang S, Wang Z, Yang Q, Fu S
            and Dong K.
  TITLE     MiR-375 promotes cisplatin sensitivity of lung adenocarcinoma
  JOURNAL   Pathol Res Pract 249, 154765 (2023)
   PUBMED   37625279
  REMARK    GeneRIF: MiR-375 promotes cisplatin sensitivity of lung
            adenocarcinoma.
REFERENCE   3  (bases 1 to 64)
  AUTHORS   Moorthy RK, Srinivasan C, Kannan M and Arockiam AJV.
  TITLE     Deregulation of miR-375 Inhibits HOXA5 and Promotes Migration,
            Invasion, and Cell Proliferation in Breast Cancer
  JOURNAL   Appl Biochem Biotechnol 195 (7), 4503-4523 (2023)
   PUBMED   36701095
  REMARK    GeneRIF: Deregulation of miR-375 Inhibits HOXA5 and Promotes
            Migration, Invasion, and Cell Proliferation in Breast Cancer.
REFERENCE   4  (bases 1 to 64)
  AUTHORS   Chen J, Cai Z, Hu J, Zhou L, Zhang P and Xu X.
  TITLE     MicroRNA-375 in extracellular vesicles - novel marker for
            esophageal cancer diagnosis
  JOURNAL   Medicine (Baltimore) 102 (5), e32826 (2023)
   PUBMED   36749234
  REMARK    GeneRIF: MicroRNA-375 in extracellular vesicles - novel marker for
            esophageal cancer diagnosis.
REFERENCE   5  (bases 1 to 64)
  AUTHORS   Lu T, Yang D and Li X.
  TITLE     CircFAT1 Promotes the Proliferation and Invasion of Malignant
            Melanoma through miR375-SLC7A11 Signal Axis
  JOURNAL   Anticancer Agents Med Chem 23 (20), 2200-2208 (2023)
   PUBMED   37303180
  REMARK    GeneRIF: CircFAT1 Promotes the Proliferation and Invasion of
            Malignant Melanoma through miR375-SLC7A11 Signal Axis.
REFERENCE   6  (bases 1 to 64)
  AUTHORS   Liu AM, Poon RT and Luk JM.
  TITLE     MicroRNA-375 targets Hippo-signaling effector YAP in liver cancer
            and inhibits tumor properties
  JOURNAL   Biochem Biophys Res Commun 394 (3), 623-627 (2010)
   PUBMED   20226166
  REMARK    GeneRIF: miR-375 is an important regulator of YAP oncogene playing
            the role in hepatocellular carcinoma development.
REFERENCE   7  (bases 1 to 64)
  AUTHORS   Baroukh NN and Van Obberghen E.
  TITLE     Function of microRNA-375 and microRNA-124a in pancreas and brain
  JOURNAL   FEBS J 276 (22), 6509-6521 (2009)
   PUBMED   20102393
  REMARK    Review article
REFERENCE   8  (bases 1 to 64)
  AUTHORS   Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A,
            Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND,
            Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U,
            Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien
            M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung
            V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G,
            Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P,
            Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C,
            Zavolan M and Tuschl T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   9  (bases 1 to 64)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   10 (bases 1 to 64)
  AUTHORS   Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE,
            Pfeffer S, Tuschl T, Rajewsky N, Rorsman P and Stoffel M.
  TITLE     A pancreatic islet-specific microRNA regulates insulin secretion
  JOURNAL   Nature 432 (7014), 226-230 (2004)
   PUBMED   15538371
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC097468.3.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM608701.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-64                AC097468.3         81283-81346         c
FEATURES             Location/Qualifiers
     source          1..64
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q35"
     gene            1..64
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /note="microRNA 375"
                     /db_xref="GeneID:494324"
                     /db_xref="HGNC:HGNC:31868"
                     /db_xref="MIM:611173"
                     /db_xref="miRBase:MI0000783"
     precursor_RNA   1..64
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /product="microRNA 375"
                     /db_xref="GeneID:494324"
                     /db_xref="HGNC:HGNC:31868"
                     /db_xref="MIM:611173"
                     /db_xref="miRBase:MI0000783"
     exon            1..64
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952152088"
     variation       4
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2106027163"
     ncRNA           5..27
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /product="hsa-miR-375-5p"
                     /db_xref="miRBase:MIMAT0037313"
                     /db_xref="GeneID:494324"
                     /db_xref="HGNC:HGNC:31868"
                     /db_xref="MIM:611173"
                     /db_xref="miRBase:MI0000783"
     variation       5
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990524627"
     variation       7
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996281351"
     variation       9
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262819504"
     variation       10
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1945630567"
     variation       13
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1207124480"
     variation       15
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1945630498"
     variation       16
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484983849"
     variation       18
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285474297"
     variation       21
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1945630391"
     variation       26
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1945630352"
     variation       28
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1945630321"
     variation       29
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1945630280"
     variation       34
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246796367"
     variation       35
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959229647"
     variation       36
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034831221"
     variation       37
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1945630145"
     ncRNA           40..61
                     /ncRNA_class="miRNA"
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /product="hsa-miR-375-3p"
                     /db_xref="miRBase:MIMAT0000728"
                     /db_xref="GeneID:494324"
                     /db_xref="HGNC:HGNC:31868"
                     /db_xref="MIM:611173"
                     /db_xref="miRBase:MI0000783"
     variation       42
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1945630106"
     variation       47
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1945630057"
     variation       49
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1018778367"
     variation       53
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982331454"
     variation       55
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1945629901"
     variation       56
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243615194"
     variation       57
                     /gene="MIR375"
                     /gene_synonym="hsa-mir-375; mir-375; MIRN375; miRNA375"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751522848"
ORIGIN      

ccccgcgacgagcccctcgcacaaaccggacctgagcgttttgttcgttcggctcgcgtgaggc

//