GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:21:50, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_027278               1962 bp    RNA     linear   PRI 22-JUL-2018
DEFINITION  Homo sapiens family with sequence similarity 230 member C
            (FAM230C), long non-coding RNA.
ACCESSION   NR_027278 XR_015528 XR_040812
VERSION     NR_027278.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1962)
  AUTHORS   Delihas N.
  TITLE     A family of long intergenic non-coding RNA genes in human
            chromosomal region 22q11.2 carry a DNA translocation
            breakpoint/AT-rich sequence
  JOURNAL   PLoS ONE 13 (4), e0195702 (2018)
   PUBMED   29668722
  REMARK    GeneRIF: FAM230C contains copies of the DNA translocation
            breakpoint/AT-rich sequence.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1962)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
REFERENCE   3  (bases 1 to 1962)
  AUTHORS   Ota T, Suzuki Y, Nishikawa T, Otsuki T, Sugiyama T, Irie R,
            Wakamatsu A, Hayashi K, Sato H, Nagai K, Kimura K, Makita H, Sekine
            M, Obayashi M, Nishi T, Shibahara T, Tanaka T, Ishii S, Yamamoto J,
            Saito K, Kawai Y, Isono Y, Nakamura Y, Nagahari K, Murakami K,
            Yasuda T, Iwayanagi T, Wagatsuma M, Shiratori A, Sudo H, Hosoiri T,
            Kaku Y, Kodaira H, Kondo H, Sugawara M, Takahashi M, Kanda K, Yokoi
            T, Furuya T, Kikkawa E, Omura Y, Abe K, Kamihara K, Katsuta N, Sato
            K, Tanikawa M, Yamazaki M, Ninomiya K, Ishibashi T, Yamashita H,
            Murakawa K, Fujimori K, Tanai H, Kimata M, Watanabe M, Hiraoka S,
            Chiba Y, Ishida S, Ono Y, Takiguchi S, Watanabe S, Yosida M, Hotuta
            T, Kusano J, Kanehori K, Takahashi-Fujii A, Hara H, Tanase TO,
            Nomura Y, Togiya S, Komai F, Hara R, Takeuchi K, Arita M, Imose N,
            Musashino K, Yuuki H, Oshima A, Sasaki N, Aotsuka S, Yoshikawa Y,
            Matsunawa H, Ichihara T, Shiohata N, Sano S, Moriya S, Momiyama H,
            Satoh N, Takami S, Terashima Y, Suzuki O, Nakagawa S, Senoh A,
            Mizoguchi H, Goto Y, Shimizu F, Wakebe H, Hishigaki H, Watanabe T,
            Sugiyama A, Takemoto M, Kawakami B, Yamazaki M, Watanabe K, Kumagai
            A, Itakura S, Fukuzumi Y, Fujimori Y, Komiyama M, Tashiro H,
            Tanigami A, Fujiwara T, Ono T, Yamada K, Fujii Y, Ozaki K, Hirao M,
            Ohmori Y, Kawabata A, Hikiji T, Kobatake N, Inagaki H, Ikema Y,
            Okamoto S, Okitani R, Kawakami T, Noguchi S, Itoh T, Shigeta K,
            Senba T, Matsumura K, Nakajima Y, Mizuno T, Morinaga M, Sasaki M,
            Togashi T, Oyama M, Hata H, Watanabe M, Komatsu T, Mizushima-Sugano
            J, Satoh T, Shirai Y, Takahashi Y, Nakagawa K, Okumura K, Nagase T,
            Nomura N, Kikuchi H, Masuho Y, Yamashita R, Nakai K, Yada T,
            Nakamura Y, Ohara O, Isogai T and Sugano S.
  TITLE     Complete sequencing and characterization of 21,243 full-length
            human cDNAs
  JOURNAL   Nat. Genet. 36 (1), 40-45 (2004)
   PUBMED   14702039
REFERENCE   4  (bases 1 to 1962)
  AUTHORS   Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD,
            Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg
            B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T,
            Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin
            GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL,
            Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P,
            Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy
            SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH,
            Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW,
            Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J,
            Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M,
            Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW,
            Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J,
            Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U,
            Smailus DE, Schnerch A, Schein JE, Jones SJ and Marra MA.
  CONSRTM   Mammalian Gene Collection Program Team
  TITLE     Generation and initial analysis of more than 15,000 full-length
            human and mouse cDNA sequences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002)
   PUBMED   12477932
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC040613.2, DB056745.1 and AL356585.7.
            On or before Mar 11, 2009 this sequence version replaced
            XR_040812.1, XR_015528.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC040613.2, SRR5189667.167055.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2148874, SAMEA2151119
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-266               BC040613.2         1-266
            267-663             DB056745.1         144-540
            664-835             BC040613.2         658-829
            836-1962            AL356585.7         59642-60768
FEATURES             Location/Qualifiers
     source          1..1962
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="13"
                     /map="13q11"
     gene            1..1962
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /note="family with sequence similarity 230 member C"
                     /db_xref="GeneID:26080"
                     /db_xref="HGNC:HGNC:24482"
     ncRNA           1..1962
                     /ncRNA_class="lncRNA"
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /product="family with sequence similarity 230 member C"
                     /db_xref="GeneID:26080"
                     /db_xref="HGNC:HGNC:24482"
     exon            1..115
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363592281"
     variation       2..3
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1320477692"
     variation       3
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458040342"
     variation       4
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1347370370"
     variation       8
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426168138"
     variation       9
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195538741"
     variation       10
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447739485"
     variation       12
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246055395"
     variation       13
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486069814"
     variation       16
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262310643"
     variation       17
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1207558838"
     variation       24
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280635482"
     variation       25
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235764284"
     variation       27
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362415476"
     variation       32
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297487608"
     variation       33
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436543863"
     variation       37
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364501002"
     variation       38
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301415132"
     variation       40
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447804370"
     variation       42
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359896835"
     variation       44
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175774608"
     variation       48
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427891686"
     variation       51
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1389703383"
     variation       58
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167852034"
     variation       59
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1429098551"
     variation       61
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1263791798"
     variation       62
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482807278"
     variation       63
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257704004"
     variation       69
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212643847"
     variation       71
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339436963"
     variation       73
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273331916"
     variation       78
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227553055"
     variation       82
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309740620"
     variation       84
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1311219036"
     variation       89
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228049843"
     variation       93
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356569213"
     variation       97
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315002512"
     variation       104
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408278788"
     variation       107
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370002442"
     variation       111
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308661331"
     variation       112
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463619952"
     variation       113
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374656969"
     exon            116..174
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       119
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293003843"
     variation       122
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357567595"
     variation       123
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304990886"
     variation       129
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1374137103"
     variation       130
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298732739"
     variation       131
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467063959"
     variation       140
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392020356"
     variation       141
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163890202"
     variation       143
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461660041"
     variation       148
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419637430"
     variation       154
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179187247"
     variation       156
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1418071477"
     variation       160
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250601219"
     variation       161
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1819615"
     variation       164
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272982647"
     exon            175..199
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       177
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1443590074"
     variation       188
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379706337"
     variation       189..192
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="caca"
                     /replace="cacaca"
                     /db_xref="dbSNP:1324431401"
     exon            200..286
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       202
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190865775"
     variation       203
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427729455"
     variation       205
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262120050"
     variation       206
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190238952"
     variation       208
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459742779"
     variation       216
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262110968"
     variation       225
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1346417837"
     variation       231
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250139199"
     variation       232
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227273910"
     variation       234
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1308476797"
     variation       238
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300312442"
     variation       239
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450881838"
     variation       240
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337630066"
     variation       245
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397873609"
     variation       247
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166120404"
     variation       253
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461458816"
     variation       254
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:71213897"
     variation       256
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170322459"
     variation       257
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442543773"
     variation       258
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242146675"
     variation       261
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187739013"
     variation       262..271
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="aagaaga"
                     /replace="aagaagaaga"
                     /db_xref="dbSNP:386832923"
     variation       264
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1247752953"
     variation       268
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1194704620"
     variation       269
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1481273490"
     variation       272
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277379215"
     variation       273
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359098124"
     variation       277
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247213839"
     variation       280
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1334177344"
     variation       286
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328333672"
     exon            287..352
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       295
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218527949"
     variation       302
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345930522"
     variation       304
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284891896"
     variation       311
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1397824394"
     variation       312
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339430486"
     variation       324
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288996768"
     variation       325
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454862696"
     variation       334
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356891400"
     variation       339
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176002280"
     exon            353..414
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       364
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1480096799"
     variation       381
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251965000"
     variation       382
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1206638609"
     variation       388
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356589085"
     variation       395
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291718681"
     variation       398
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246092904"
     variation       399
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323883344"
     variation       408
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305302942"
     variation       409
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391089513"
     exon            415..448
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       417
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276703192"
     variation       418
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226468652"
     variation       420
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355459795"
     variation       433
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284552446"
     variation       437
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1246592192"
     variation       438
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333588139"
     variation       439
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306985277"
     variation       440
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4081314"
     variation       444
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301844017"
     exon            449..1962
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /inference="alignment:Splign:2.1.0"
     variation       457
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424132242"
     variation       458
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419596423"
     variation       460
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179493567"
     variation       466
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471983165"
     variation       467
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1207997229"
     variation       471
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487780642"
     variation       473
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1265270634"
     variation       476
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222814347"
     variation       477
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323830638"
     variation       478
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228011182"
     variation       479
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290264563"
     variation       480
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388528281"
     variation       493
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292819467"
     variation       494
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1458229041"
     variation       496..498
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1396315672"
     variation       498
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156594339"
     variation       499
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1456368966"
     variation       501
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1183313236"
     variation       503
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430912898"
     variation       504..506
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="ctc"
                     /db_xref="dbSNP:35970506"
     variation       506
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1192225649"
     variation       508..509
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1470161585"
     variation       511
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266609506"
     variation       538..541
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1208400947"
     variation       540
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330050553"
     variation       541
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270201334"
     variation       544
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231184457"
     variation       546
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300504600"
     variation       548
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387276859"
     variation       557
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372991622"
     variation       565
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318276756"
     variation       568
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456419308"
     variation       569
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566276258"
     variation       576
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388961125"
     variation       577
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159888016"
     variation       579
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1464118517"
     variation       583
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376511067"
     variation       586
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177496284"
     variation       587
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455946975"
     variation       593..594
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1188362240"
     variation       593
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465587374"
     variation       605
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264136477"
     variation       619
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198875461"
     variation       620
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344481534"
     variation       623
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1256653644"
     variation       627
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233946198"
     variation       631
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349931704"
     variation       633
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295263855"
     variation       634
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434122615"
     variation       638
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365590173"
     variation       641
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319887034"
     variation       644..645
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1393914961"
     variation       645
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400927927"
     variation       651
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302886369"
     variation       656
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435996959"
     variation       662
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388880047"
     variation       664
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168437960"
     variation       668
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450483329"
     variation       669
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375133828"
     variation       675
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185764901"
     variation       677
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442041347"
     variation       679
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1257005519"
     variation       680
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213155362"
     variation       681
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1482087260"
     variation       684
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339911717"
     variation       685
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271689651"
     variation       686
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242206682"
     variation       689
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339538937"
     variation       693
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334346849"
     variation       696
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416100390"
     variation       697
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1368085074"
     variation       699
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308030895"
     variation       700
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430936283"
     variation       705
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566276302"
     variation       710
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399147330"
     variation       723
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1161796983"
     variation       727
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472653684"
     variation       742
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1369292719"
     variation       746
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190258236"
     variation       757
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471655245"
     variation       763
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251166164"
     variation       764
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204407036"
     variation       765
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438291960"
     variation       769
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1274979949"
     variation       770
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1355303881"
     variation       771
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234741128"
     variation       774
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348146580"
     variation       777
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287135734"
     variation       778
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411018737"
     variation       781
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338084053"
     variation       790
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1322094579"
     variation       790
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405155385"
     variation       791
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391824482"
     variation       800
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167459302"
     variation       807
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455831847"
     variation       811
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1411377337"
     variation       814
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183023639"
     variation       818
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471172526"
     variation       821
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234543761"
     variation       828
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1450883980"
     variation       833
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273564343"
     variation       836
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1326608708"
     variation       836
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4081312"
     variation       837..838
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="cct"
                     /replace="cctt"
                     /db_xref="dbSNP:1436385988"
     variation       837
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1273585787"
     variation       837
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1223879673"
     variation       838..847
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="ttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /replace="ttttttttttt"
                     /db_xref="dbSNP:1388207929"
     variation       838
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160107907"
     variation       842
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402524509"
     variation       844..845
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1170805797"
     variation       844
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1423143749"
     variation       849
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1477642809"
     variation       854
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1253439183"
     variation       855
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195302977"
     variation       860
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463342382"
     variation       865
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215980940"
     variation       867
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318270721"
     variation       869
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275882133"
     variation       872
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219209998"
     variation       882
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306208437"
     variation       886
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364836767"
     variation       887
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289735066"
     variation       889
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433134198"
     variation       891
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1333552419"
     variation       892
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395641316"
     variation       892
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1357546158"
     variation       898
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175376919"
     variation       900
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1447442851"
     variation       910..911
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:1186804830"
     variation       911
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486631661"
     variation       918
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235343468"
     variation       921
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1208842583"
     variation       922
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485679204"
     variation       928
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203622942"
     variation       933
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341964570"
     variation       935..936
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1296706578"
     variation       946
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566276420"
     variation       949
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216585940"
     variation       951
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377288547"
     variation       953
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283771091"
     variation       957
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415494350"
     variation       958
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377288203"
     variation       959..960
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1314739887"
     variation       960
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427729005"
     variation       963
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353759926"
     variation       967
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170845555"
     variation       970
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430029915"
     variation       974
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1411196488"
     variation       983
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1180851385"
     variation       984..988
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="cccc"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1258984842"
     variation       988
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203692833"
     variation       989
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:28657470"
     variation       990
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1482995709"
     variation       993
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1207095271"
     variation       997
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320234599"
     variation       998
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289441761"
     variation       1000
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1234129354"
     variation       1005
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357515458"
     variation       1006
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286508291"
     variation       1008
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407965208"
     variation       1013
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1372549973"
     variation       1015
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463336198"
     variation       1019
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347897694"
     variation       1021
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163829228"
     variation       1022
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461615492"
     variation       1027..1031
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="caaat"
                     /replace="caaatcaaat"
                     /db_xref="dbSNP:1179428223"
     variation       1031
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417954627"
     variation       1038
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251891857"
     variation       1040
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179399493"
     variation       1041
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487750338"
     variation       1045
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246475680"
     variation       1046
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214606565"
     variation       1057
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:74549447"
     variation       1064
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266432105"
     variation       1067
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227874059"
     variation       1068
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317524557"
     variation       1070
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307698638"
     variation       1075
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393052982"
     variation       1077
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365283662"
     variation       1082
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324933429"
     variation       1088
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1441308806"
     variation       1093
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396248280"
     variation       1094
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1156431209"
     variation       1101
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363875039"
     variation       1105
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161987369"
     variation       1106
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1431927148"
     variation       1112
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252810964"
     variation       1115
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194690503"
     variation       1121
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470057522"
     variation       1128
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246425719"
     variation       1129
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208338122"
     variation       1131
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486266072"
     variation       1133
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262546091"
     variation       1140
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241146797"
     variation       1145
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1310397925"
     variation       1147
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302524139"
     variation       1155
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234767178"
     variation       1158..1163
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="ttccca"
                     /replace="ttcccattccca"
                     /db_xref="dbSNP:1372826702"
     variation       1162
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318211832"
     variation       1164
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381290921"
     variation       1165
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385115719"
     variation       1166
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290089203"
     variation       1167
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464073310"
     variation       1174
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395038148"
     variation       1175
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174739384"
     variation       1182
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:28640894"
     variation       1188
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388688970"
     variation       1192
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192803674"
     variation       1200
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429305386"
     variation       1205
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9550304"
     variation       1208
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264074870"
     variation       1211
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198820741"
     variation       1217
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485351207"
     variation       1218
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279531072"
     variation       1219
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211504070"
     variation       1224..1229
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="tgtg"
                     /replace="tgtgtg"
                     /db_xref="dbSNP:1349860156"
     variation       1224
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1295100600"
     variation       1229
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9604584"
     variation       1230
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326693127"
     variation       1237
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297217196"
     variation       1244
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393808270"
     variation       1250
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1374313140"
     variation       1259
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314081411"
     variation       1262
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437095522"
     variation       1267
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369139883"
     variation       1275
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167728545"
     variation       1277
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475917513"
     variation       1279
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375014609"
     variation       1282
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185609671"
     variation       1285
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474960547"
     variation       1290
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1258300161"
     variation       1296
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1188635097"
     variation       1297
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486595794"
     variation       1303
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270753530"
     variation       1304
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195034099"
     variation       1305
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339763360"
     variation       1315
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231058738"
     variation       1316
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354322696"
     variation       1318
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416047067"
     variation       1322
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349198073"
     variation       1329
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328702605"
     variation       1330
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1410882669"
     variation       1332
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399078878"
     variation       1340
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161739197"
     variation       1341
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461097536"
     variation       1343
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1418715964"
     variation       1346
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4112881"
     variation       1347
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471625117"
     variation       1348
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180918255"
     variation       1353
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438239610"
     variation       1354
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252374491"
     variation       1356
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211478359"
     variation       1357
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:9550303"
     variation       1358
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1347836910"
     variation       1359..1366
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="gtatggcc"
                     /replace="gtatggccgtatggcc"
                     /db_xref="dbSNP:1279557708"
     variation       1368
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337955507"
     variation       1372..1374
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1321953321"
     variation       1376
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440583386"
     variation       1377
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1395526647"
     variation       1383
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167299604"
     variation       1384..1387
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1455717982"
     variation       1384
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9577955"
     variation       1390
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365420818"
     variation       1392
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191538805"
     variation       1393
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467820013"
     variation       1394
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:9550302"
     variation       1395
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4112880"
     variation       1401
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224866392"
     variation       1402..1403
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1353509677"
     variation       1403
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1301821849"
     variation       1406
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234043057"
     variation       1412
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372101536"
     variation       1413
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328257693"
     variation       1414..1419
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="cataca"
                     /replace="catacataca"
                     /db_xref="dbSNP:1555309512"
     variation       1414
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="cgtac"
                     /db_xref="dbSNP:1428859971"
     variation       1423
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319098300"
     variation       1439
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1059697"
     variation       1441
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171606246"
     variation       1445
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453642268"
     variation       1448
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395445526"
     variation       1449
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195166829"
     variation       1464
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474204907"
     variation       1471
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241119254"
     variation       1472
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215917750"
     variation       1483
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1448168053"
     variation       1484
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1278823394"
     variation       1496
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210798202"
     variation       1498
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349107673"
     variation       1499
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306040802"
     variation       1504
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1213133056"
     variation       1506
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361550287"
     variation       1513
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566276668"
     variation       1515
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1428884035"
     variation       1517..1519
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1432983330"
     variation       1524
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4112879"
     variation       1530
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311052268"
     variation       1531
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434004239"
     variation       1542
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375882223"
     variation       1545
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178004266"
     variation       1547
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407955177"
     variation       1548
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1418373231"
     variation       1551
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186682439"
     variation       1552
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476148151"
     variation       1553
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254762353"
     variation       1563
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486301583"
     variation       1564
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283023823"
     variation       1565
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202879949"
     variation       1569
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307212163"
     variation       1577
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274061081"
     variation       1592
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216534217"
     variation       1599
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353698342"
     variation       1603
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292718307"
     variation       1604
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1415433367"
     variation       1610
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304461587"
     variation       1616
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439764743"
     variation       1619
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353705968"
     variation       1622
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170783451"
     variation       1624
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466832311"
     variation       1631
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415154989"
     variation       1632
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163605930"
     variation       1635
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475213986"
     variation       1642..1648
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="cttc"
                     /replace="cttcttc"
                     /db_xref="dbSNP:1566276717"
     variation       1646
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260232931"
     variation       1649
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175983938"
     variation       1650
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480543512"
     variation       1656
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206940928"
     variation       1660
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272728463"
     variation       1661
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1233994317"
     variation       1675
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1314854125"
     variation       1676
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221994157"
     variation       1677
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1372415320"
     variation       1679
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298563699"
     variation       1685
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448654937"
     variation       1688
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391850249"
     variation       1689
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324719363"
     variation       1694
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461569311"
     variation       1698
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369678256"
     variation       1699
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157616502"
     variation       1702
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1418975571"
     variation       1703..1704
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1180924685"
     variation       1715
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467374745"
     variation       1718
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252619268"
     variation       1719
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214553834"
     variation       1722
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1469926103"
     variation       1726
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259020734"
     variation       1736
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1238365441"
     variation       1743
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1307545062"
     variation       1746
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242052269"
     variation       1751
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368509809"
     variation       1755
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302309401"
     variation       1756
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441153092"
     variation       1759
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286644037"
     variation       1762
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452373111"
     variation       1763
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160906549"
     variation       1764
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1453039621"
     variation       1765
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1394846993"
     variation       1766
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194562389"
     variation       1773
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435100955"
     variation       1775
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259850452"
     variation       1776..1780
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1204639455"
     variation       1779
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1486195564"
     variation       1782
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261305257"
     variation       1801
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218685317"
     variation       1806
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345528558"
     variation       1813
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279301667"
     variation       1822
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332485015"
     variation       1824
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292927928"
     variation       1827
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381167412"
     variation       1829
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362038492"
     variation       1830
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300656275"
     variation       1843
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1433380940"
     variation       1844
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375269338"
     variation       1847
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174677233"
     variation       1853..1857
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="t"
                     /replace="tcttt"
                     /db_xref="dbSNP:1467845198"
     variation       1856
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371559194"
     variation       1857
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192737523"
     variation       1861
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429255193"
     variation       1865
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265398500"
     variation       1877
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1195808420"
     variation       1880
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484667694"
     variation       1881
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279460748"
     variation       1898
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200837181"
     variation       1905
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1346780964"
     variation       1908
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249328394"
     variation       1924
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307624790"
     variation       1924
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="t"
                     /replace="tattt"
                     /db_xref="dbSNP:1226227092"
     variation       1925..1931
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="tgt"
                     /replace="tgtatgt"
                     /db_xref="dbSNP:1279510834"
     variation       1928
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412343371"
     variation       1933
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313947144"
     variation       1940
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398222955"
     variation       1946..1948
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1394762457"
     variation       1948
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566276818"
     variation       1955
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167607161"
     variation       1960
                     /gene="FAM230C"
                     /gene_synonym="LINC00281; NCRNA00281"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462658846"
ORIGIN      
gccgagactgcgcttcgtgcgaggcccgggcagcatcggcggcgtggtcagagcgagtctcggagaagatgtggtggcttccgtttgttggtggaggaggtggcaggcctcggcggtgactcgaagaattcttccaaaaagcgtgtgaaaagggagccctactctactaccaaggtgacttcagggagcacattcaatgagaatacaagaagatatgctgtgcacaccaaccagtgtcggagacctcatggctccccggtaaagaagaagatgtacccacaagaagatgacttccatcatacaatcttcagcaaccttgaaagattggacaagcttcagcccactcttgaagcctctgaggagtctctagttcacaaggacagaggagatggagagaggccagtcaacgtgagggtggtgcaggtggcccctctgaggcgtgaatctatgactcctctaccctcaccagagccatccccgggtctgccttattatcccgactactcaggtggagaacctgaagggccaagggagtggccccagctcctgagttcctgaatgaaaaagtgaaaacacgaacccaggagtgtgggccagtgctgacactgacatgcacttagtcatggagtgttcaccaccacacagggagttcagcattcatctataagccctaaagcaccgagcccaaaaggccccagacactgcccatcatcataaagtggcctctgtggtcacacaacccagggcagttataggctcatctccccacggacaggcatagtcatcagtgtgtcaaaagcacaaagatccccaggtgttttgctcagctcacagatcttttttttttaacttttaagttcaggggtacatgtgcaggatgtgcaggtttgctacatatagaaatgtgtgtcatgagagtttgttgtacagattattgcatcacccatacattgagcctaatatcagctatttttcctgatcctccccctcctcccacctcccaccctccagtgggccccacgctcacaaattctaagaggagtgggggaccacaaatgccagtgtggcccacttcagttgtgaagttaatttgctcagcagctggccaaagcctgtaaggatgggtgatgtattttagtagatttagtaatactatcttcccaagccctaaaatgctcaaaacctgccagccaaaaatggtgaggagggacagataggaactctgtgtggcacttggttattagcctggcttccatcccttagtggcaactctcttgtatatgtgggttaaagaccctcagcctcaagccaagcctcctccatgaggagccatctcactattgactggctagtgccgggtatggccaccagcccaactgaaacaaaatgttgctttaaaacaagtgtaaatctcatacaacaggcaaatgcagaagcaatgtggtctcgcaagttgtaaagaggacagtcgcaattttgctggacttcaacctgggtagaagacatgagggaactctgtcactgaatcacggcagagttcaaggccacttgtagactatttcatgttacagaaggtagcctttagctactaagcaaaggcctcggtttctcatttctttcctgttcatcttcttggtcatccttcttccgcaagggaaacgagcccaagcaaaaggcagtttcaatattaatttgaccgaggttttgtgcagtttattatcatccaggtaatcaggtgcaacccagtctgcctagcagcccccctctctctgctctgtgttttcatttaataaacattttggtctacttactatgtgctagattttctcgagaccaagtaaatgagatagaatctttatgttggcagctaagttagatttaacataactgacaaaaattaaaatttctgatttcttgtaaaaattgtatgtgtgaatgcatactgaaagtaaagtggttaac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]