ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-01-22 22:25:36, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_024393 1412 bp RNA linear PRI 26-FEB-2023
DEFINITION Homo sapiens cancer susceptibility 8 (CASC8), transcript variant 2,
long non-coding RNA.
ACCESSION NR_024393
VERSION NR_024393.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1412)
AUTHORS Mitroi AF, Leopa N, Dumitru E, Dumitru A, Tocia C, Popescu I,
Mitroi A and Popescu RC.
TITLE TCF7L2, CASC8, and GREM1 polymorphism and colorectal cancer in
south-eastern Romanian population
JOURNAL Medicine (Baltimore) 102 (7), e33056 (2023)
PUBMED 36800588
REMARK GeneRIF: TCF7L2, CASC8, and GREM1 polymorphism and colorectal
cancer in south-eastern Romanian population.
REFERENCE 2 (bases 1 to 1412)
AUTHORS Mitroi AF, Leopa N, Dumitru E, Brinzan C, Tocia C, Dumitru A and
Popescu RC.
TITLE Association of TCF7L2, CASC8 and GREM1 Polymorphisms in Patients
with Colorectal Cancer and Type II Diabetes Mellitus
JOURNAL Genes (Basel) 13 (8), 1297 (2022)
PUBMED 35893034
REMARK GeneRIF: Association of TCF7L2, CASC8 and GREM1 Polymorphisms in
Patients with Colorectal Cancer and Type II Diabetes Mellitus.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1412)
AUTHORS Wu Q, Zhang H, Yang D, Min Q, Wang Y, Zhang W and Zhan Q.
TITLE The m6A-induced lncRNA CASC8 promotes proliferation and
chemoresistance via upregulation of hnRNPL in esophageal squamous
cell carcinoma
JOURNAL Int J Biol Sci 18 (13), 4824-4836 (2022)
PUBMED 35982900
REMARK GeneRIF: The m6A-induced lncRNA CASC8 promotes proliferation and
chemoresistance via upregulation of hnRNPL in esophageal squamous
cell carcinoma.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 1412)
AUTHORS Lu Y, Yuan W, Wang L, Ning M, Han Y, Gu W, Zhao T, Shang F and Guo
X.
TITLE Contribution of lncRNA CASC8, CASC11, and PVT1 Genetic Variants to
the Susceptibility of Coronary Heart Disease
JOURNAL J Cardiovasc Pharmacol 77 (6), 756-766 (2021)
PUBMED 34001726
REMARK GeneRIF: Contribution of lncRNA CASC8, CASC11, and PVT1 Genetic
Variants to the Susceptibility of Coronary Heart Disease.
REFERENCE 5 (bases 1 to 1412)
AUTHORS Sang Y, Gu H, Chen Y, Shi Y, Liu C, Lv L, Sun Y and Zhang Y.
TITLE Long non-coding RNA CASC8 polymorphisms are associated with the
risk of esophageal cancer in a Chinese population
JOURNAL Thorac Cancer 11 (10), 2852-2857 (2020)
PUBMED 32875717
REMARK GeneRIF: Long non-coding RNA CASC8 polymorphisms are associated
with the risk of esophageal cancer in a Chinese population.
REFERENCE 6 (bases 1 to 1412)
AUTHORS Gudmundsson J, Sulem P, Gudbjartsson DF, Blondal T, Gylfason A,
Agnarsson BA, Benediktsdottir KR, Magnusdottir DN, Orlygsdottir G,
Jakobsdottir M, Stacey SN, Sigurdsson A, Wahlfors T, Tammela T,
Breyer JP, McReynolds KM, Bradley KM, Saez B, Godino J, Navarrete
S, Fuertes F, Murillo L, Polo E, Aben KK, van Oort IM, Suarez BK,
Helfand BT, Kan D, Zanon C, Frigge ML, Kristjansson K, Gulcher JR,
Einarsson GV, Jonsson E, Catalona WJ, Mayordomo JI, Kiemeney LA,
Smith JR, Schleutker J, Barkardottir RB, Kong A, Thorsteinsdottir
U, Rafnar T and Stefansson K.
TITLE Genome-wide association and replication studies identify four
variants associated with prostate cancer susceptibility
JOURNAL Nat Genet 41 (10), 1122-1126 (2009)
PUBMED 19767754
REFERENCE 7 (bases 1 to 1412)
AUTHORS Tenesa A, Farrington SM, Prendergast JG, Porteous ME, Walker M, Haq
N, Barnetson RA, Theodoratou E, Cetnarskyj R, Cartwright N, Semple
C, Clark AJ, Reid FJ, Smith LA, Kavoussanakis K, Koessler T,
Pharoah PD, Buch S, Schafmayer C, Tepel J, Schreiber S, Volzke H,
Schmidt CO, Hampe J, Chang-Claude J, Hoffmeister M, Brenner H,
Wilkening S, Canzian F, Capella G, Moreno V, Deary IJ, Starr JM,
Tomlinson IP, Kemp Z, Howarth K, Carvajal-Carmona L, Webb E,
Broderick P, Vijayakrishnan J, Houlston RS, Rennert G, Ballinger D,
Rozek L, Gruber SB, Matsuda K, Kidokoro T, Nakamura Y, Zanke BW,
Greenwood CM, Rangrej J, Kustra R, Montpetit A, Hudson TJ,
Gallinger S, Campbell H and Dunlop MG.
TITLE Genome-wide association scan identifies a colorectal cancer
susceptibility locus on 11q23 and replicates risk loci at 8q24 and
18q21
JOURNAL Nat Genet 40 (5), 631-637 (2008)
PUBMED 18372901
REFERENCE 8 (bases 1 to 1412)
AUTHORS Gudmundsson J, Sulem P, Manolescu A, Amundadottir LT, Gudbjartsson
D, Helgason A, Rafnar T, Bergthorsson JT, Agnarsson BA, Baker A,
Sigurdsson A, Benediktsdottir KR, Jakobsdottir M, Xu J, Blondal T,
Kostic J, Sun J, Ghosh S, Stacey SN, Mouy M, Saemundsdottir J,
Backman VM, Kristjansson K, Tres A, Partin AW, Albers-Akkers MT,
Godino-Ivan Marcos J, Walsh PC, Swinkels DW, Navarrete S, Isaacs
SD, Aben KK, Graif T, Cashy J, Ruiz-Echarri M, Wiley KE, Suarez BK,
Witjes JA, Frigge M, Ober C, Jonsson E, Einarsson GV, Mayordomo JI,
Kiemeney LA, Isaacs WB, Catalona WJ, Barkardottir RB, Gulcher JR,
Thorsteinsdottir U, Kong A and Stefansson K.
TITLE Genome-wide association study identifies a second prostate cancer
susceptibility variant at 8q24
JOURNAL Nat Genet 39 (5), 631-637 (2007)
PUBMED 17401366
REFERENCE 9 (bases 1 to 1412)
AUTHORS Yeager M, Orr N, Hayes RB, Jacobs KB, Kraft P, Wacholder S,
Minichiello MJ, Fearnhead P, Yu K, Chatterjee N, Wang Z, Welch R,
Staats BJ, Calle EE, Feigelson HS, Thun MJ, Rodriguez C, Albanes D,
Virtamo J, Weinstein S, Schumacher FR, Giovannucci E, Willett WC,
Cancel-Tassin G, Cussenot O, Valeri A, Andriole GL, Gelmann EP,
Tucker M, Gerhard DS, Fraumeni JF Jr, Hoover R, Hunter DJ, Chanock
SJ and Thomas G.
TITLE Genome-wide association study of prostate cancer identifies a
second risk locus at 8q24
JOURNAL Nat Genet 39 (5), 645-649 (2007)
PUBMED 17401363
REFERENCE 10 (bases 1 to 1412)
AUTHORS Amundadottir LT, Sulem P, Gudmundsson J, Helgason A, Baker A,
Agnarsson BA, Sigurdsson A, Benediktsdottir KR, Cazier JB, Sainz J,
Jakobsdottir M, Kostic J, Magnusdottir DN, Ghosh S, Agnarsson K,
Birgisdottir B, Le Roux L, Olafsdottir A, Blondal T, Andresdottir
M, Gretarsdottir OS, Bergthorsson JT, Gudbjartsson D, Gylfason A,
Thorleifsson G, Manolescu A, Kristjansson K, Geirsson G, Isaksson
H, Douglas J, Johansson JE, Balter K, Wiklund F, Montie JE, Yu X,
Suarez BK, Ober C, Cooney KA, Gronberg H, Catalona WJ, Einarsson
GV, Barkardottir RB, Gulcher JR, Kong A, Thorsteinsdottir U and
Stefansson K.
TITLE A common variant associated with prostate cancer in European and
African populations
JOURNAL Nat Genet 38 (6), 652-658 (2006)
PUBMED 16682969
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC016883.14.
Transcript Variant: This variant (2) lacks two exons and contains
an alternate 3' terminal exon, resulting in a shorter transcript,
compared to variant 1.
Sequence Note: The RefSeq transcript was derived from the reference
genome assembly. The genomic coordinates were determined from
alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: DQ515896.1 [ECO:0000332]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-506 AC016883.14 166280-166785 c
507-850 AC016883.14 165374-165717 c
851-953 AC016883.14 164350-164452 c
954-1041 AC016883.14 163729-163816 c
1042-1412 AC016883.14 127996-128366 c
FEATURES Location/Qualifiers
source 1..1412
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q24.21"
gene 1..1412
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/note="cancer susceptibility 8"
/db_xref="GeneID:727677"
/db_xref="HGNC:HGNC:45129"
/db_xref="MIM:617701"
ncRNA 1..1412
/ncRNA_class="lncRNA"
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/product="cancer susceptibility 8, transcript variant 2"
/db_xref="GeneID:727677"
/db_xref="HGNC:HGNC:45129"
/db_xref="MIM:617701"
exon 1..506
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/inference="alignment:Splign:2.1.0"
variation 3
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:2129726190"
variation 5
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:80339277"
variation 8
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:949719812"
variation 10
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1474987936"
variation 11
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:916898038"
variation 12
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:2129726153"
variation 15..17
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:774653348"
variation 15
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816024717"
variation 18
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2129726133"
variation 22
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816024649"
variation 24
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1195277114"
variation 25
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:546402673"
variation 30
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816024519"
variation 31
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816024487"
variation 34
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1478068478"
variation 35
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:2536624198"
variation 36
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816024417"
variation 38
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816024386"
variation 39
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816024353"
variation 46
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816024331"
variation 47
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace=""
/replace="t"
/db_xref="dbSNP:1010718641"
variation 48
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:891909431"
variation 51
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816024227"
variation 53
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1390796379"
variation 54
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2536624183"
variation 55
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:991262844"
variation 60
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1033112853"
variation 61
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1239508243"
variation 62
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1000338849"
variation 66
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:889997173"
variation 67
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:533030848"
variation 69
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1201812878"
variation 72
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:541951671"
variation 76
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1483853668"
variation 80
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:750558309"
variation 82..105
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="acttccttcaggtttcactcagaa"
/db_xref="dbSNP:1816023405"
variation 86..87
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="cc"
/db_xref="dbSNP:998484023"
variation 92
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:796255171"
variation 93
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816023651"
variation 94
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1421187907"
variation 98
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1183375980"
variation 99
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816023540"
variation 100
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816023499"
variation 101
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1428111717"
variation 102
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:2536624100"
variation 107
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:920477768"
variation 108
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1479273367"
variation 111
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816023327"
variation 117
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:973646594"
variation 118
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816023260"
variation 123
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816023224"
variation 125
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:961869852"
variation 126
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1292351922"
variation 127
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1429447372"
variation 130
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1040065706"
variation 131
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1210612987"
variation 132
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1014807804"
variation 136
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1391709563"
variation 144
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:765211591"
variation 150
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:2129725869"
variation 154
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816022886"
variation 157
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:907642447"
variation 158
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2536624062"
variation 161
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022801"
variation 162
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816022773"
variation 163..164
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="cc"
/replace="ccc"
/db_xref="dbSNP:1816022706"
variation 163
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022734"
variation 165
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285260078"
variation 167
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2129725829"
variation 169
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022677"
variation 173
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1252670616"
variation 174
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1339176723"
variation 178
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022576"
variation 188
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:550663529"
variation 189
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022490"
variation 190
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1226798095"
variation 194
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1586505592"
variation 195
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816022398"
variation 196
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1048885472"
variation 205
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022309"
variation 208
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816022274"
variation 216
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022234"
variation 220
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:535969894"
variation 223
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816022173"
variation 225
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1481923097"
variation 227
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816022109"
variation 229
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816022078"
variation 230
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1206270315"
variation 231..234
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="ttt"
/replace="tttt"
/replace="ttttt"
/db_xref="dbSNP:1268682685"
variation 237
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1489711648"
variation 248
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1008744651"
variation 252
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816021834"
variation 253
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816021805"
variation 254
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:954739645"
variation 260..279
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="cctgcctcacctgcctcacc"
/replace="cctgcctcacctgcctcacctgcctcacc"
/db_xref="dbSNP:1816021327"
variation 260
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1283194998"
variation 261
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816021711"
variation 262
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2536623991"
variation 268
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1402600430"
variation 270
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:927142260"
variation 272
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816021596"
variation 274
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:9643224"
variation 276
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:77820992"
variation 278
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816021367"
variation 284
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816021281"
variation 289
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1430377960"
variation 293
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816021186"
variation 294
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2129725608"
variation 295
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1363549620"
variation 296
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:917224916"
variation 298
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2129725593"
variation 300
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816021037"
variation 303
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2536623947"
variation 312
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816021004"
variation 322
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:988842910"
variation 323
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816020932"
variation 328
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1408968760"
variation 331
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace=""
/replace="t"
/db_xref="dbSNP:1816020857"
variation 334..336
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="ccc"
/db_xref="dbSNP:1816020656"
variation 334
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1368594940"
variation 338
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1381673651"
variation 339
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1293569398"
variation 342..345
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace=""
/replace="tctt"
/db_xref="dbSNP:1309754026"
variation 346
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229857161"
variation 347
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816020524"
variation 348
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816020491"
variation 351
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1291496212"
variation 354
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:191080683"
variation 360
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1357655810"
variation 363
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:759597626"
variation 367
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:187805471"
variation 368
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816020333"
variation 369
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace=""
/replace="a"
/db_xref="dbSNP:1816020299"
variation 375
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1485358851"
variation 376
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:956101389"
variation 378
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1053843234"
variation 381
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:764451754"
variation 382
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816020090"
variation 384
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426258592"
variation 389
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816020028"
variation 394
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:954206332"
variation 395
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816019381"
variation 402
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:79306777"
variation 406
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1453376205"
variation 407
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816019244"
variation 408
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816019207"
variation 417
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1479511971"
variation 419
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1248490446"
variation 420
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816019087"
variation 421
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816019056"
variation 422
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1199862609"
variation 426
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816018981"
variation 428
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816018957"
variation 433
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1435909738"
variation 437
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1314891490"
variation 442
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:546421438"
variation 444
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1381253510"
variation 446..449
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="aaa"
/replace="aaaa"
/db_xref="dbSNP:998828301"
variation 449
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1248571430"
variation 451
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:577571575"
variation 452
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1046703095"
variation 453
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1248665998"
variation 454
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:949600976"
variation 456
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816018611"
variation 459
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1464906327"
variation 461
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1200985282"
variation 462
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816018516"
variation 464
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:76022738"
variation 467
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:886153433"
variation 470
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1055863932"
variation 475
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1446409236"
variation 476
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:78312141"
variation 477
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816018204"
variation 481
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:930418737"
variation 482..494
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="gagagagag"
/replace="gagagagagag"
/replace="gagagagagagag"
/replace="gagagagagagagag"
/db_xref="dbSNP:1274855222"
variation 483
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:2129725261"
variation 486
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1157105529"
variation 488
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1391124163"
variation 489
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816017924"
variation 490
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="ggg"
/db_xref="dbSNP:1336197682"
variation 490
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:146701301"
variation 491
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:973147011"
variation 492
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1450880744"
variation 494
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2536623870"
variation 495
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1285144048"
variation 496
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816017579"
variation 503
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1373144662"
exon 507..850
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/inference="alignment:Splign:2.1.0"
variation 507
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:2129723961"
variation 508
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816006147"
variation 511
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816006115"
variation 514
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816006087"
variation 518
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816006023"
variation 521
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816005996"
variation 522
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:982960951"
variation 529
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:779117526"
variation 530
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1427855937"
variation 533
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1034364789"
variation 534
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1586505102"
variation 536
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1186668435"
variation 538
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:952915360"
variation 540
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1027243687"
variation 542
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1162662771"
variation 544
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816005641"
variation 547
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816005598"
variation 550
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816005566"
variation 552
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816005549"
variation 555
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:995755432"
variation 557
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1349545554"
variation 559
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1586505092"
variation 560
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1664992065"
variation 561
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816005425"
variation 562
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:898861285"
variation 565
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1037368986"
variation 567
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:940322627"
variation 568
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816005286"
variation 573
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391452100"
variation 577
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816005230"
variation 578
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1381711109"
variation 580
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816005160"
variation 583
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:2536623392"
variation 588..589
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1296114247"
variation 590
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:544076389"
variation 591
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:886198348"
variation 592
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2536623384"
variation 593
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2536623383"
variation 594
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229649635"
variation 596
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816004989"
variation 597
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1426464415"
variation 600
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1051434240"
variation 604
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1265660136"
variation 606
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816004823"
variation 610
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1485292409"
variation 612
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2536623372"
variation 613
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1206258633"
variation 617
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1249862436"
variation 618
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1171978508"
variation 619
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1449960129"
variation 620
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:933175263"
variation 624
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:575045095"
variation 625
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:561695653"
variation 632
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:374232100"
variation 633
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816004580"
variation 636
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:975096288"
variation 644
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:760998528"
variation 645
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:925313393"
variation 646..655
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="aataaa"
/replace="aataaataaa"
/db_xref="dbSNP:1192572929"
variation 652
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816004424"
variation 657
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1488568855"
variation 660
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1231940863"
variation 661
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816004276"
variation 664
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816004244"
variation 666
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:978087677"
variation 667
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1436390761"
variation 670
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1042945411"
variation 671
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816004123"
variation 672
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816004087"
variation 677
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:997203564"
variation 678
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816004023"
variation 681
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:966666031"
variation 689
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1025076550"
variation 692..694
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="aa"
/replace="aaa"
/db_xref="dbSNP:1226072438"
variation 694
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1315926564"
variation 696
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:992219450"
variation 703
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816003872"
variation 705
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1586505005"
variation 711
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:944107786"
variation 717
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1202877449"
variation 718
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:541464998"
variation 720
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816003687"
variation 722
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:565227865"
variation 725
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1182205959"
variation 728
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816003589"
variation 729
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:572566010"
variation 730
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2129723510"
variation 737
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1414842737"
variation 738
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816003499"
variation 739
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1472360569"
variation 743
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:754077566"
variation 744
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1414194164"
variation 746
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816003362"
variation 749
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2290033"
variation 751
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:185811100"
variation 752
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816003176"
variation 754
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1176051040"
variation 756
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816003119"
variation 757
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:2129723444"
variation 758
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816003091"
variation 764
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816003060"
variation 765
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:2129723436"
variation 769
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1357905672"
variation 773
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816002995"
variation 774
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1004518906"
variation 775
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1816002925"
variation 776
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816002894"
variation 777
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816002865"
variation 780
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1368659156"
variation 781
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1816002787"
variation 782
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:576606714"
variation 785
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:920126887"
variation 787
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2129723375"
variation 793
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:981017381"
variation 796
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816002500"
variation 798
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:74466606"
variation 799
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1051485154"
variation 801
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:2536623195"
variation 805
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816002369"
variation 813
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:537318112"
variation 814
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1313845283"
variation 816
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1332662867"
variation 820
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:377622271"
variation 823
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:568287595"
variation 827
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:900364912"
variation 830
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816002154"
variation 831..833
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace=""
/replace="cat"
/db_xref="dbSNP:1816002063"
variation 831
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1816002128"
variation 832
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1816002098"
variation 833
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1469676710"
variation 834
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1038861032"
variation 835..844
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="tcctcct"
/replace="tcctcctcct"
/db_xref="dbSNP:2536623170"
variation 843
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1816001970"
variation 846
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1816001928"
exon 851..953
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/inference="alignment:Splign:2.1.0"
variation 852
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815990516"
variation 854
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:902739530"
variation 857
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1043947953"
variation 864
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1280734955"
variation 865
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815990356"
variation 867
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815990327"
variation 868
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:887202214"
variation 869
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:567746855"
variation 870
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1586504540"
variation 873
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:7831028"
variation 877
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:534196661"
variation 878
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:922757011"
variation 880
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815989779"
variation 884
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815989753"
variation 885
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815989727"
variation 887
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:550701062"
variation 891
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1332532742"
variation 900
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:763520560"
variation 901
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:912334411"
variation 903
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050878258"
variation 907
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815989492"
variation 913
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815989458"
variation 916
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815989435"
variation 917
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815989385"
variation 918
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815989351"
variation 923
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1203131880"
variation 928
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1678342251"
variation 930
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1234608294"
variation 936
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1323775278"
variation 942
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:550722779"
variation 943
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:929804927"
variation 944
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815989102"
variation 945
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:910257535"
variation 948
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:2536622223"
variation 951
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:148344941"
variation 952
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815988999"
variation 953
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:973965657"
exon 954..1041
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/inference="alignment:Splign:2.1.0"
variation 957
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815980602"
variation 959
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1025477513"
variation 961..962
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace=""
/replace="c"
/db_xref="dbSNP:1815980529"
variation 961
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1815980558"
variation 962
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1358912873"
variation 965
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815980442"
variation 967
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815980401"
variation 968
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:976729276"
variation 975
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1465064397"
variation 976
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:895005246"
variation 977
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:75035821"
variation 982
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1018798813"
variation 985
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1371525508"
variation 988..990
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="t"
/replace="tct"
/db_xref="dbSNP:1463617033"
variation 994
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1586504208"
variation 997
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:2536621695"
variation 999
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815980120"
variation 1004
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1168517320"
variation 1007
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:927956767"
variation 1009
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:978076930"
variation 1010
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:528798665"
variation 1012
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:904722353"
variation 1017
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:879098243"
variation 1019
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1372254409"
variation 1021..1023
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="gg"
/replace="ggg"
/db_xref="dbSNP:2129720020"
variation 1021
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:114475594"
variation 1022
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1815979774"
variation 1023
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815979730"
variation 1024..1026
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1474092066"
variation 1024
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1180629864"
variation 1027
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1308846027"
variation 1031
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2129719996"
variation 1032
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1227540446"
variation 1034..1040
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="aaaaaa"
/replace="aaaaaaa"
/replace="aaaaaaaa"
/db_xref="dbSNP:1215551052"
variation 1034
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1815979475"
variation 1035
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1264280961"
variation 1036
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815979405"
variation 1040
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815979322"
exon 1042..1412
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/inference="alignment:Splign:2.1.0"
variation 1042
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:2536592712"
variation 1045
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1305689237"
variation 1052
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815489418"
variation 1054..1064
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="ta"
/replace="tagggccgcta"
/db_xref="dbSNP:1815489224"
variation 1054
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815489396"
variation 1058
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1815489365"
variation 1060
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:563290588"
variation 1061
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:980009742"
variation 1062
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1263073720"
variation 1064
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:538861410"
variation 1066..1067
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace=""
/replace="tggaa"
/db_xref="dbSNP:1815489171"
variation 1067
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815489142"
variation 1070
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1815489108"
variation 1073
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1329213250"
variation 1075
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815489050"
variation 1080
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815489025"
variation 1085
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815488995"
variation 1086
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487778292"
variation 1088..1096
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="agagaga"
/replace="agagagaga"
/db_xref="dbSNP:150051060"
variation 1089
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1235232082"
variation 1091
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815488888"
variation 1096
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815488810"
variation 1100
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:189858726"
variation 1105
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:149407254"
variation 1106
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:115959661"
variation 1110
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815488714"
variation 1115
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1205878233"
variation 1117
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:2130652597"
variation 1118
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815488665"
variation 1132
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:893805938"
variation 1135
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1586487875"
variation 1137
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815488549"
variation 1141
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1229364922"
variation 1142
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1815488482"
variation 1143
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1431929649"
variation 1146
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1053740088"
variation 1147
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300321973"
variation 1148
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1815488344"
variation 1149
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1815488306"
variation 1157
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:541211270"
variation 1158
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:2536592648"
variation 1161
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1000709504"
variation 1169
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:185495421"
variation 1170
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2130652565"
variation 1172
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1300292624"
variation 1183
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1388426393"
variation 1184
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:202022217"
variation 1185
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:78768365"
variation 1186
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1225822832"
variation 1187
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1046975740"
variation 1188
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815487828"
variation 1194
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1218014981"
variation 1195
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:949582507"
variation 1199
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1344577116"
variation 1208
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1229301760"
variation 1209
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1264915631"
variation 1214
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1487815666"
variation 1219
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1328087550"
variation 1221
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1461973064"
variation 1222
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1212186948"
variation 1223
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1815487542"
variation 1224
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1268608419"
variation 1225
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1815487486"
variation 1231
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:77052479"
variation 1234
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1399855595"
variation 1238
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1815487382"
variation 1239
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1347577689"
variation 1244
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:749337992"
variation 1248
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815487271"
variation 1249
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815487240"
variation 1252
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815487213"
variation 1253
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:2082426231"
variation 1255
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815487177"
variation 1256
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1186997022"
variation 1257
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1815487103"
variation 1258
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1391708047"
variation 1260
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1449686607"
variation 1266
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815486988"
variation 1267
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815486951"
variation 1268
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:74794158"
variation 1269
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1815486802"
variation 1272
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815486772"
variation 1276
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815486745"
variation 1277..1281
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="aaaa"
/replace="aaaaa"
/db_xref="dbSNP:1815486687"
variation 1278
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1586487808"
variation 1290
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2536592586"
variation 1291
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:575965700"
variation 1294
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815486616"
variation 1296
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1374034428"
variation 1297..1305
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="caga"
/replace="cagatcaga"
/db_xref="dbSNP:1815486514"
variation 1297
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1163781305"
variation 1302
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1384066605"
variation 1308
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:991228406"
variation 1313
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:7831606"
variation 1314
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:560125646"
variation 1316
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:973092297"
variation 1319
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815486375"
variation 1323
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1312233253"
variation 1326
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:2536592553"
variation 1330
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815486324"
variation 1332
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1320026382"
variation 1334
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1247011937"
variation 1336..1337
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="aa"
/db_xref="dbSNP:1255365452"
variation 1337
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1815486193"
variation 1338
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1266552428"
variation 1339
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1329076501"
variation 1340
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:886129229"
variation 1342
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:567236685"
variation 1344
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1250266800"
variation 1345
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1048791820"
variation 1348
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815485956"
variation 1349
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1180943701"
variation 1353
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:6981397"
variation 1359
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:553980863"
variation 1360..1363
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="tg"
/replace="tgtg"
/db_xref="dbSNP:1815485684"
variation 1360
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:534353103"
variation 1361
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="g"
/replace="t"
/db_xref="dbSNP:1815485719"
variation 1363
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:954562364"
variation 1366
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:979936788"
variation 1368
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815485552"
variation 1371
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:781584216"
variation 1377
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1029283025"
variation 1379
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="g"
/db_xref="dbSNP:1815485449"
variation 1381
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:996200376"
variation 1384
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2536592489"
variation 1385
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815485380"
variation 1386
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:1815485347"
variation 1388..1395
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="aa"
/replace="aaataaaa"
/db_xref="dbSNP:1815485266"
variation 1388
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:1586487754"
variation 1393
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:988785478"
variation 1394
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2536592476"
variation 1395
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/db_xref="dbSNP:116495814"
variation 1398
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="c"
/replace="t"
/db_xref="dbSNP:925974617"
variation 1399
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1377165608"
variation 1400
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1815485139"
variation 1403
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:1815485113"
variation 1406
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1815485089"
variation 1408
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="g"
/db_xref="dbSNP:2536592464"
variation 1409
/gene="CASC8"
/gene_synonym="CARLo-1; CARLO1; LINC00860"
/replace="a"
/replace="t"
/db_xref="dbSNP:1815485055"
ORIGIN
tgaaccaccccaggccctttgcacctgctattccctctcctcagcatgctctgccccagacaattgcaatgctaacttcttacttccttcaggtttcactcagaaatgactttctcagtggggtctcccatgaccattttatttaagatttcaactactttgccagtatttcacttctcctcccttgatcttttcttccaagcactcactgccctcttgcacactgtatcttttacttatttatcttgttcagtttctgcctgcctcacctgcctcaccacagtgtacatttcacgagggcagggattttgtctgttttgttgattgctgtagccctggcatcttgggcagtgccagcacctgttagcattaaatacatatttactgaatgaatgagtggcttcatgcttaaaagcaagaagagagaccttcatagagaagtaggaaaatgaattgttgcacaaataaagggccatgtaatgagagagagagagcaagagaaagagcaaacaattaaggagcagcagtggcttcctgcaggggagaccaatgccttctgtcctcagcggaaacagcttggcattcttccaattgatgaatggcatggaccaggagcactagttatcttcagcttctgagcatccgaataaataaacatacaaatgcataacataaaataaattcaaattacaaatgagaaaaccaatctaggttaccggcaagtcctatgacttgatgtggaggcctggaagtgcatccttgaatcttgcaatgcagtgagccaaggagcaatgagaggccacatgaataaccgggccagtgacaagacacatgtcctcctccttgctggtatacaccagaatgccccgcatgcagcgaatgctcaaaaagtgttggtggaagtgacagaattccatcaccattaaacacaaccagtgttgcggttgacaatggcactgaagcaggtgaaaaatccgtacagcagcttctgtctttgaagagtttgcagcctcttgaagagggtttagaggttaaaaaaaggacccaggctgatagggccgctaccatttggaaagtgacaagaggaagagagagaatgaaacaacagtaagcactggctctcagcttctacctgaagagacaaacattgctttcacttacatttcactggccaaatcaagcccatggcaacaattgagttcaaaagcataaggaggtatctggaaggaagagaatcagaaaatttctgatgagcctcactgactaccttcagggcaaaaaggaagagaggcactccagatcagagatctgcattggaaactccttgagaaccagaagggtatgctgtatttttgtaactgtgaggagcccagaaagactgaagcccaaataaaattcctttattcaatatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]