GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-14 14:26:48, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       NR_024393               1412 bp    RNA     linear   PRI 26-FEB-2023
DEFINITION  Homo sapiens cancer susceptibility 8 (CASC8), transcript variant 2,
            long non-coding RNA.
ACCESSION   NR_024393
VERSION     NR_024393.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1412)
  AUTHORS   Mitroi AF, Leopa N, Dumitru E, Dumitru A, Tocia C, Popescu I,
            Mitroi A and Popescu RC.
  TITLE     TCF7L2, CASC8, and GREM1 polymorphism and colorectal cancer in
            south-eastern Romanian population
  JOURNAL   Medicine (Baltimore) 102 (7), e33056 (2023)
   PUBMED   36800588
  REMARK    GeneRIF: TCF7L2, CASC8, and GREM1 polymorphism and colorectal
            cancer in south-eastern Romanian population.
REFERENCE   2  (bases 1 to 1412)
  AUTHORS   Mitroi AF, Leopa N, Dumitru E, Brinzan C, Tocia C, Dumitru A and
            Popescu RC.
  TITLE     Association of TCF7L2, CASC8 and GREM1 Polymorphisms in Patients
            with Colorectal Cancer and Type II Diabetes Mellitus
  JOURNAL   Genes (Basel) 13 (8), 1297 (2022)
   PUBMED   35893034
  REMARK    GeneRIF: Association of TCF7L2, CASC8 and GREM1 Polymorphisms in
            Patients with Colorectal Cancer and Type II Diabetes Mellitus.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1412)
  AUTHORS   Wu Q, Zhang H, Yang D, Min Q, Wang Y, Zhang W and Zhan Q.
  TITLE     The m6A-induced lncRNA CASC8 promotes proliferation and
            chemoresistance via upregulation of hnRNPL in esophageal squamous
            cell carcinoma
  JOURNAL   Int J Biol Sci 18 (13), 4824-4836 (2022)
   PUBMED   35982900
  REMARK    GeneRIF: The m6A-induced lncRNA CASC8 promotes proliferation and
            chemoresistance via upregulation of hnRNPL in esophageal squamous
            cell carcinoma.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1412)
  AUTHORS   Lu Y, Yuan W, Wang L, Ning M, Han Y, Gu W, Zhao T, Shang F and Guo
            X.
  TITLE     Contribution of lncRNA CASC8, CASC11, and PVT1 Genetic Variants to
            the Susceptibility of Coronary Heart Disease
  JOURNAL   J Cardiovasc Pharmacol 77 (6), 756-766 (2021)
   PUBMED   34001726
  REMARK    GeneRIF: Contribution of lncRNA CASC8, CASC11, and PVT1 Genetic
            Variants to the Susceptibility of Coronary Heart Disease.
REFERENCE   5  (bases 1 to 1412)
  AUTHORS   Sang Y, Gu H, Chen Y, Shi Y, Liu C, Lv L, Sun Y and Zhang Y.
  TITLE     Long non-coding RNA CASC8 polymorphisms are associated with the
            risk of esophageal cancer in a Chinese population
  JOURNAL   Thorac Cancer 11 (10), 2852-2857 (2020)
   PUBMED   32875717
  REMARK    GeneRIF: Long non-coding RNA CASC8 polymorphisms are associated
            with the risk of esophageal cancer in a Chinese population.
REFERENCE   6  (bases 1 to 1412)
  AUTHORS   Gudmundsson J, Sulem P, Gudbjartsson DF, Blondal T, Gylfason A,
            Agnarsson BA, Benediktsdottir KR, Magnusdottir DN, Orlygsdottir G,
            Jakobsdottir M, Stacey SN, Sigurdsson A, Wahlfors T, Tammela T,
            Breyer JP, McReynolds KM, Bradley KM, Saez B, Godino J, Navarrete
            S, Fuertes F, Murillo L, Polo E, Aben KK, van Oort IM, Suarez BK,
            Helfand BT, Kan D, Zanon C, Frigge ML, Kristjansson K, Gulcher JR,
            Einarsson GV, Jonsson E, Catalona WJ, Mayordomo JI, Kiemeney LA,
            Smith JR, Schleutker J, Barkardottir RB, Kong A, Thorsteinsdottir
            U, Rafnar T and Stefansson K.
  TITLE     Genome-wide association and replication studies identify four
            variants associated with prostate cancer susceptibility
  JOURNAL   Nat Genet 41 (10), 1122-1126 (2009)
   PUBMED   19767754
REFERENCE   7  (bases 1 to 1412)
  AUTHORS   Tenesa A, Farrington SM, Prendergast JG, Porteous ME, Walker M, Haq
            N, Barnetson RA, Theodoratou E, Cetnarskyj R, Cartwright N, Semple
            C, Clark AJ, Reid FJ, Smith LA, Kavoussanakis K, Koessler T,
            Pharoah PD, Buch S, Schafmayer C, Tepel J, Schreiber S, Volzke H,
            Schmidt CO, Hampe J, Chang-Claude J, Hoffmeister M, Brenner H,
            Wilkening S, Canzian F, Capella G, Moreno V, Deary IJ, Starr JM,
            Tomlinson IP, Kemp Z, Howarth K, Carvajal-Carmona L, Webb E,
            Broderick P, Vijayakrishnan J, Houlston RS, Rennert G, Ballinger D,
            Rozek L, Gruber SB, Matsuda K, Kidokoro T, Nakamura Y, Zanke BW,
            Greenwood CM, Rangrej J, Kustra R, Montpetit A, Hudson TJ,
            Gallinger S, Campbell H and Dunlop MG.
  TITLE     Genome-wide association scan identifies a colorectal cancer
            susceptibility locus on 11q23 and replicates risk loci at 8q24 and
            18q21
  JOURNAL   Nat Genet 40 (5), 631-637 (2008)
   PUBMED   18372901
REFERENCE   8  (bases 1 to 1412)
  AUTHORS   Gudmundsson J, Sulem P, Manolescu A, Amundadottir LT, Gudbjartsson
            D, Helgason A, Rafnar T, Bergthorsson JT, Agnarsson BA, Baker A,
            Sigurdsson A, Benediktsdottir KR, Jakobsdottir M, Xu J, Blondal T,
            Kostic J, Sun J, Ghosh S, Stacey SN, Mouy M, Saemundsdottir J,
            Backman VM, Kristjansson K, Tres A, Partin AW, Albers-Akkers MT,
            Godino-Ivan Marcos J, Walsh PC, Swinkels DW, Navarrete S, Isaacs
            SD, Aben KK, Graif T, Cashy J, Ruiz-Echarri M, Wiley KE, Suarez BK,
            Witjes JA, Frigge M, Ober C, Jonsson E, Einarsson GV, Mayordomo JI,
            Kiemeney LA, Isaacs WB, Catalona WJ, Barkardottir RB, Gulcher JR,
            Thorsteinsdottir U, Kong A and Stefansson K.
  TITLE     Genome-wide association study identifies a second prostate cancer
            susceptibility variant at 8q24
  JOURNAL   Nat Genet 39 (5), 631-637 (2007)
   PUBMED   17401366
REFERENCE   9  (bases 1 to 1412)
  AUTHORS   Yeager M, Orr N, Hayes RB, Jacobs KB, Kraft P, Wacholder S,
            Minichiello MJ, Fearnhead P, Yu K, Chatterjee N, Wang Z, Welch R,
            Staats BJ, Calle EE, Feigelson HS, Thun MJ, Rodriguez C, Albanes D,
            Virtamo J, Weinstein S, Schumacher FR, Giovannucci E, Willett WC,
            Cancel-Tassin G, Cussenot O, Valeri A, Andriole GL, Gelmann EP,
            Tucker M, Gerhard DS, Fraumeni JF Jr, Hoover R, Hunter DJ, Chanock
            SJ and Thomas G.
  TITLE     Genome-wide association study of prostate cancer identifies a
            second risk locus at 8q24
  JOURNAL   Nat Genet 39 (5), 645-649 (2007)
   PUBMED   17401363
REFERENCE   10 (bases 1 to 1412)
  AUTHORS   Amundadottir LT, Sulem P, Gudmundsson J, Helgason A, Baker A,
            Agnarsson BA, Sigurdsson A, Benediktsdottir KR, Cazier JB, Sainz J,
            Jakobsdottir M, Kostic J, Magnusdottir DN, Ghosh S, Agnarsson K,
            Birgisdottir B, Le Roux L, Olafsdottir A, Blondal T, Andresdottir
            M, Gretarsdottir OS, Bergthorsson JT, Gudbjartsson D, Gylfason A,
            Thorleifsson G, Manolescu A, Kristjansson K, Geirsson G, Isaksson
            H, Douglas J, Johansson JE, Balter K, Wiklund F, Montie JE, Yu X,
            Suarez BK, Ober C, Cooney KA, Gronberg H, Catalona WJ, Einarsson
            GV, Barkardottir RB, Gulcher JR, Kong A, Thorsteinsdottir U and
            Stefansson K.
  TITLE     A common variant associated with prostate cancer in European and
            African populations
  JOURNAL   Nat Genet 38 (6), 652-658 (2006)
   PUBMED   16682969
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC016883.14.
            
            Transcript Variant: This variant (2) lacks two exons and contains
            an alternate 3' terminal exon, resulting in a shorter transcript,
            compared to variant 1.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DQ515896.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-506               AC016883.14        166280-166785       c
            507-850             AC016883.14        165374-165717       c
            851-953             AC016883.14        164350-164452       c
            954-1041            AC016883.14        163729-163816       c
            1042-1412           AC016883.14        127996-128366       c
FEATURES             Location/Qualifiers
     source          1..1412
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q24.21"
     gene            1..1412
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /note="cancer susceptibility 8"
                     /db_xref="GeneID:727677"
                     /db_xref="HGNC:HGNC:45129"
                     /db_xref="MIM:617701"
     ncRNA           1..1412
                     /ncRNA_class="lncRNA"
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /product="cancer susceptibility 8, transcript variant 2"
                     /db_xref="GeneID:727677"
                     /db_xref="HGNC:HGNC:45129"
                     /db_xref="MIM:617701"
     exon            1..506
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       3
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2129726190"
     variation       5
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:80339277"
     variation       8
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949719812"
     variation       10
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1474987936"
     variation       11
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916898038"
     variation       12
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2129726153"
     variation       15..17
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:774653348"
     variation       15
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816024717"
     variation       18
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2129726133"
     variation       22
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816024649"
     variation       24
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195277114"
     variation       25
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546402673"
     variation       30
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816024519"
     variation       31
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816024487"
     variation       34
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478068478"
     variation       35
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2536624198"
     variation       36
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816024417"
     variation       38
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816024386"
     variation       39
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816024353"
     variation       46
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816024331"
     variation       47
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1010718641"
     variation       48
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891909431"
     variation       51
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816024227"
     variation       53
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390796379"
     variation       54
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2536624183"
     variation       55
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991262844"
     variation       60
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033112853"
     variation       61
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239508243"
     variation       62
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000338849"
     variation       66
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889997173"
     variation       67
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:533030848"
     variation       69
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201812878"
     variation       72
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541951671"
     variation       76
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483853668"
     variation       80
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750558309"
     variation       82..105
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="acttccttcaggtttcactcagaa"
                     /db_xref="dbSNP:1816023405"
     variation       86..87
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:998484023"
     variation       92
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796255171"
     variation       93
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816023651"
     variation       94
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421187907"
     variation       98
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183375980"
     variation       99
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816023540"
     variation       100
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816023499"
     variation       101
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428111717"
     variation       102
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2536624100"
     variation       107
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920477768"
     variation       108
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1479273367"
     variation       111
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816023327"
     variation       117
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:973646594"
     variation       118
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816023260"
     variation       123
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816023224"
     variation       125
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961869852"
     variation       126
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292351922"
     variation       127
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429447372"
     variation       130
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040065706"
     variation       131
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1210612987"
     variation       132
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014807804"
     variation       136
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391709563"
     variation       144
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765211591"
     variation       150
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2129725869"
     variation       154
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816022886"
     variation       157
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907642447"
     variation       158
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2536624062"
     variation       161
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022801"
     variation       162
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816022773"
     variation       163..164
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1816022706"
     variation       163
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022734"
     variation       165
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285260078"
     variation       167
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2129725829"
     variation       169
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022677"
     variation       173
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252670616"
     variation       174
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339176723"
     variation       178
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022576"
     variation       188
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550663529"
     variation       189
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022490"
     variation       190
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226798095"
     variation       194
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586505592"
     variation       195
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816022398"
     variation       196
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048885472"
     variation       205
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022309"
     variation       208
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816022274"
     variation       216
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022234"
     variation       220
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535969894"
     variation       223
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816022173"
     variation       225
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481923097"
     variation       227
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816022109"
     variation       229
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816022078"
     variation       230
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1206270315"
     variation       231..234
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="ttt"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1268682685"
     variation       237
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1489711648"
     variation       248
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008744651"
     variation       252
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816021834"
     variation       253
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816021805"
     variation       254
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954739645"
     variation       260..279
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="cctgcctcacctgcctcacc"
                     /replace="cctgcctcacctgcctcacctgcctcacc"
                     /db_xref="dbSNP:1816021327"
     variation       260
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283194998"
     variation       261
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816021711"
     variation       262
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2536623991"
     variation       268
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402600430"
     variation       270
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:927142260"
     variation       272
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816021596"
     variation       274
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9643224"
     variation       276
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77820992"
     variation       278
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816021367"
     variation       284
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816021281"
     variation       289
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430377960"
     variation       293
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816021186"
     variation       294
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2129725608"
     variation       295
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363549620"
     variation       296
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917224916"
     variation       298
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2129725593"
     variation       300
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816021037"
     variation       303
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2536623947"
     variation       312
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816021004"
     variation       322
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988842910"
     variation       323
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816020932"
     variation       328
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408968760"
     variation       331
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1816020857"
     variation       334..336
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1816020656"
     variation       334
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1368594940"
     variation       338
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381673651"
     variation       339
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293569398"
     variation       342..345
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="tctt"
                     /db_xref="dbSNP:1309754026"
     variation       346
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229857161"
     variation       347
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816020524"
     variation       348
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816020491"
     variation       351
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291496212"
     variation       354
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191080683"
     variation       360
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357655810"
     variation       363
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759597626"
     variation       367
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187805471"
     variation       368
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816020333"
     variation       369
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1816020299"
     variation       375
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485358851"
     variation       376
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956101389"
     variation       378
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053843234"
     variation       381
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764451754"
     variation       382
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816020090"
     variation       384
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426258592"
     variation       389
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816020028"
     variation       394
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:954206332"
     variation       395
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816019381"
     variation       402
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79306777"
     variation       406
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1453376205"
     variation       407
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816019244"
     variation       408
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816019207"
     variation       417
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479511971"
     variation       419
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248490446"
     variation       420
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816019087"
     variation       421
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816019056"
     variation       422
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199862609"
     variation       426
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816018981"
     variation       428
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816018957"
     variation       433
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435909738"
     variation       437
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314891490"
     variation       442
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546421438"
     variation       444
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381253510"
     variation       446..449
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:998828301"
     variation       449
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1248571430"
     variation       451
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577571575"
     variation       452
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046703095"
     variation       453
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248665998"
     variation       454
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949600976"
     variation       456
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816018611"
     variation       459
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464906327"
     variation       461
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200985282"
     variation       462
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816018516"
     variation       464
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76022738"
     variation       467
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886153433"
     variation       470
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055863932"
     variation       475
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446409236"
     variation       476
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78312141"
     variation       477
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816018204"
     variation       481
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930418737"
     variation       482..494
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="gagagagag"
                     /replace="gagagagagag"
                     /replace="gagagagagagag"
                     /replace="gagagagagagagag"
                     /db_xref="dbSNP:1274855222"
     variation       483
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2129725261"
     variation       486
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157105529"
     variation       488
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391124163"
     variation       489
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816017924"
     variation       490
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="ggg"
                     /db_xref="dbSNP:1336197682"
     variation       490
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146701301"
     variation       491
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973147011"
     variation       492
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1450880744"
     variation       494
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2536623870"
     variation       495
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285144048"
     variation       496
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816017579"
     variation       503
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373144662"
     exon            507..850
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       507
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2129723961"
     variation       508
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816006147"
     variation       511
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816006115"
     variation       514
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816006087"
     variation       518
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816006023"
     variation       521
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816005996"
     variation       522
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:982960951"
     variation       529
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779117526"
     variation       530
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427855937"
     variation       533
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1034364789"
     variation       534
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586505102"
     variation       536
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186668435"
     variation       538
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952915360"
     variation       540
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027243687"
     variation       542
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162662771"
     variation       544
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816005641"
     variation       547
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816005598"
     variation       550
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816005566"
     variation       552
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816005549"
     variation       555
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995755432"
     variation       557
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349545554"
     variation       559
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586505092"
     variation       560
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1664992065"
     variation       561
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816005425"
     variation       562
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898861285"
     variation       565
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037368986"
     variation       567
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940322627"
     variation       568
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816005286"
     variation       573
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391452100"
     variation       577
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816005230"
     variation       578
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381711109"
     variation       580
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816005160"
     variation       583
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2536623392"
     variation       588..589
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1296114247"
     variation       590
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:544076389"
     variation       591
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886198348"
     variation       592
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2536623384"
     variation       593
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2536623383"
     variation       594
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229649635"
     variation       596
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816004989"
     variation       597
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426464415"
     variation       600
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1051434240"
     variation       604
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265660136"
     variation       606
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816004823"
     variation       610
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485292409"
     variation       612
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2536623372"
     variation       613
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1206258633"
     variation       617
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249862436"
     variation       618
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171978508"
     variation       619
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449960129"
     variation       620
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933175263"
     variation       624
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:575045095"
     variation       625
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561695653"
     variation       632
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374232100"
     variation       633
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816004580"
     variation       636
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975096288"
     variation       644
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760998528"
     variation       645
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925313393"
     variation       646..655
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aataaa"
                     /replace="aataaataaa"
                     /db_xref="dbSNP:1192572929"
     variation       652
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816004424"
     variation       657
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488568855"
     variation       660
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231940863"
     variation       661
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816004276"
     variation       664
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816004244"
     variation       666
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978087677"
     variation       667
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436390761"
     variation       670
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042945411"
     variation       671
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816004123"
     variation       672
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816004087"
     variation       677
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997203564"
     variation       678
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816004023"
     variation       681
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966666031"
     variation       689
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1025076550"
     variation       692..694
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1226072438"
     variation       694
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315926564"
     variation       696
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992219450"
     variation       703
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816003872"
     variation       705
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586505005"
     variation       711
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944107786"
     variation       717
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202877449"
     variation       718
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541464998"
     variation       720
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816003687"
     variation       722
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565227865"
     variation       725
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182205959"
     variation       728
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816003589"
     variation       729
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572566010"
     variation       730
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2129723510"
     variation       737
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414842737"
     variation       738
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816003499"
     variation       739
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472360569"
     variation       743
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754077566"
     variation       744
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414194164"
     variation       746
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816003362"
     variation       749
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2290033"
     variation       751
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185811100"
     variation       752
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816003176"
     variation       754
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176051040"
     variation       756
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816003119"
     variation       757
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2129723444"
     variation       758
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816003091"
     variation       764
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816003060"
     variation       765
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2129723436"
     variation       769
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357905672"
     variation       773
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816002995"
     variation       774
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004518906"
     variation       775
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1816002925"
     variation       776
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816002894"
     variation       777
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816002865"
     variation       780
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368659156"
     variation       781
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1816002787"
     variation       782
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:576606714"
     variation       785
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920126887"
     variation       787
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2129723375"
     variation       793
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:981017381"
     variation       796
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816002500"
     variation       798
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74466606"
     variation       799
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051485154"
     variation       801
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2536623195"
     variation       805
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816002369"
     variation       813
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537318112"
     variation       814
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313845283"
     variation       816
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332662867"
     variation       820
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377622271"
     variation       823
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:568287595"
     variation       827
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900364912"
     variation       830
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816002154"
     variation       831..833
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="cat"
                     /db_xref="dbSNP:1816002063"
     variation       831
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1816002128"
     variation       832
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1816002098"
     variation       833
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1469676710"
     variation       834
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038861032"
     variation       835..844
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="tcctcct"
                     /replace="tcctcctcct"
                     /db_xref="dbSNP:2536623170"
     variation       843
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1816001970"
     variation       846
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1816001928"
     exon            851..953
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       852
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815990516"
     variation       854
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902739530"
     variation       857
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043947953"
     variation       864
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280734955"
     variation       865
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815990356"
     variation       867
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815990327"
     variation       868
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887202214"
     variation       869
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567746855"
     variation       870
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586504540"
     variation       873
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7831028"
     variation       877
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:534196661"
     variation       878
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922757011"
     variation       880
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815989779"
     variation       884
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815989753"
     variation       885
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815989727"
     variation       887
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550701062"
     variation       891
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332532742"
     variation       900
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763520560"
     variation       901
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912334411"
     variation       903
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050878258"
     variation       907
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815989492"
     variation       913
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815989458"
     variation       916
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815989435"
     variation       917
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815989385"
     variation       918
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815989351"
     variation       923
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203131880"
     variation       928
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1678342251"
     variation       930
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234608294"
     variation       936
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323775278"
     variation       942
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550722779"
     variation       943
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:929804927"
     variation       944
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815989102"
     variation       945
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910257535"
     variation       948
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2536622223"
     variation       951
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148344941"
     variation       952
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815988999"
     variation       953
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973965657"
     exon            954..1041
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       957
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815980602"
     variation       959
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025477513"
     variation       961..962
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1815980529"
     variation       961
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1815980558"
     variation       962
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358912873"
     variation       965
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815980442"
     variation       967
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815980401"
     variation       968
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976729276"
     variation       975
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1465064397"
     variation       976
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895005246"
     variation       977
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75035821"
     variation       982
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018798813"
     variation       985
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371525508"
     variation       988..990
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="t"
                     /replace="tct"
                     /db_xref="dbSNP:1463617033"
     variation       994
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586504208"
     variation       997
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2536621695"
     variation       999
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815980120"
     variation       1004
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168517320"
     variation       1007
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927956767"
     variation       1009
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978076930"
     variation       1010
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:528798665"
     variation       1012
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904722353"
     variation       1017
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879098243"
     variation       1019
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372254409"
     variation       1021..1023
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:2129720020"
     variation       1021
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114475594"
     variation       1022
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1815979774"
     variation       1023
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815979730"
     variation       1024..1026
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1474092066"
     variation       1024
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180629864"
     variation       1027
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308846027"
     variation       1031
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2129719996"
     variation       1032
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227540446"
     variation       1034..1040
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1215551052"
     variation       1034
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1815979475"
     variation       1035
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264280961"
     variation       1036
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815979405"
     variation       1040
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815979322"
     exon            1042..1412
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /inference="alignment:Splign:2.1.0"
     variation       1042
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2536592712"
     variation       1045
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305689237"
     variation       1052
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815489418"
     variation       1054..1064
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="ta"
                     /replace="tagggccgcta"
                     /db_xref="dbSNP:1815489224"
     variation       1054
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815489396"
     variation       1058
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1815489365"
     variation       1060
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563290588"
     variation       1061
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980009742"
     variation       1062
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263073720"
     variation       1064
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538861410"
     variation       1066..1067
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace=""
                     /replace="tggaa"
                     /db_xref="dbSNP:1815489171"
     variation       1067
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815489142"
     variation       1070
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1815489108"
     variation       1073
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1329213250"
     variation       1075
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815489050"
     variation       1080
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815489025"
     variation       1085
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815488995"
     variation       1086
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487778292"
     variation       1088..1096
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="agagaga"
                     /replace="agagagaga"
                     /db_xref="dbSNP:150051060"
     variation       1089
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235232082"
     variation       1091
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815488888"
     variation       1096
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815488810"
     variation       1100
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189858726"
     variation       1105
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149407254"
     variation       1106
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115959661"
     variation       1110
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815488714"
     variation       1115
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205878233"
     variation       1117
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2130652597"
     variation       1118
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815488665"
     variation       1132
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:893805938"
     variation       1135
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1586487875"
     variation       1137
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815488549"
     variation       1141
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229364922"
     variation       1142
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1815488482"
     variation       1143
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431929649"
     variation       1146
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053740088"
     variation       1147
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300321973"
     variation       1148
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1815488344"
     variation       1149
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1815488306"
     variation       1157
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541211270"
     variation       1158
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2536592648"
     variation       1161
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000709504"
     variation       1169
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185495421"
     variation       1170
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2130652565"
     variation       1172
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300292624"
     variation       1183
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388426393"
     variation       1184
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202022217"
     variation       1185
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78768365"
     variation       1186
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225822832"
     variation       1187
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046975740"
     variation       1188
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815487828"
     variation       1194
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218014981"
     variation       1195
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949582507"
     variation       1199
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344577116"
     variation       1208
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229301760"
     variation       1209
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264915631"
     variation       1214
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487815666"
     variation       1219
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328087550"
     variation       1221
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461973064"
     variation       1222
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212186948"
     variation       1223
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1815487542"
     variation       1224
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268608419"
     variation       1225
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1815487486"
     variation       1231
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77052479"
     variation       1234
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399855595"
     variation       1238
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1815487382"
     variation       1239
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347577689"
     variation       1244
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749337992"
     variation       1248
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815487271"
     variation       1249
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815487240"
     variation       1252
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815487213"
     variation       1253
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2082426231"
     variation       1255
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815487177"
     variation       1256
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186997022"
     variation       1257
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1815487103"
     variation       1258
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391708047"
     variation       1260
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449686607"
     variation       1266
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815486988"
     variation       1267
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815486951"
     variation       1268
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74794158"
     variation       1269
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1815486802"
     variation       1272
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815486772"
     variation       1276
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815486745"
     variation       1277..1281
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1815486687"
     variation       1278
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586487808"
     variation       1290
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2536592586"
     variation       1291
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575965700"
     variation       1294
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815486616"
     variation       1296
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374034428"
     variation       1297..1305
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="caga"
                     /replace="cagatcaga"
                     /db_xref="dbSNP:1815486514"
     variation       1297
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163781305"
     variation       1302
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1384066605"
     variation       1308
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:991228406"
     variation       1313
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7831606"
     variation       1314
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560125646"
     variation       1316
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973092297"
     variation       1319
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815486375"
     variation       1323
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312233253"
     variation       1326
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2536592553"
     variation       1330
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815486324"
     variation       1332
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320026382"
     variation       1334
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1247011937"
     variation       1336..1337
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1255365452"
     variation       1337
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1815486193"
     variation       1338
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266552428"
     variation       1339
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329076501"
     variation       1340
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:886129229"
     variation       1342
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567236685"
     variation       1344
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250266800"
     variation       1345
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048791820"
     variation       1348
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815485956"
     variation       1349
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180943701"
     variation       1353
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6981397"
     variation       1359
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:553980863"
     variation       1360..1363
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1815485684"
     variation       1360
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534353103"
     variation       1361
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1815485719"
     variation       1363
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:954562364"
     variation       1366
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979936788"
     variation       1368
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815485552"
     variation       1371
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781584216"
     variation       1377
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029283025"
     variation       1379
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1815485449"
     variation       1381
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996200376"
     variation       1384
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2536592489"
     variation       1385
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815485380"
     variation       1386
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1815485347"
     variation       1388..1395
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="aa"
                     /replace="aaataaaa"
                     /db_xref="dbSNP:1815485266"
     variation       1388
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586487754"
     variation       1393
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:988785478"
     variation       1394
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2536592476"
     variation       1395
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:116495814"
     variation       1398
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925974617"
     variation       1399
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377165608"
     variation       1400
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1815485139"
     variation       1403
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1815485113"
     variation       1406
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1815485089"
     variation       1408
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2536592464"
     variation       1409
                     /gene="CASC8"
                     /gene_synonym="CARLo-1; CARLO1; LINC00860"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1815485055"
ORIGIN      
tgaaccaccccaggccctttgcacctgctattccctctcctcagcatgctctgccccagacaattgcaatgctaacttcttacttccttcaggtttcactcagaaatgactttctcagtggggtctcccatgaccattttatttaagatttcaactactttgccagtatttcacttctcctcccttgatcttttcttccaagcactcactgccctcttgcacactgtatcttttacttatttatcttgttcagtttctgcctgcctcacctgcctcaccacagtgtacatttcacgagggcagggattttgtctgttttgttgattgctgtagccctggcatcttgggcagtgccagcacctgttagcattaaatacatatttactgaatgaatgagtggcttcatgcttaaaagcaagaagagagaccttcatagagaagtaggaaaatgaattgttgcacaaataaagggccatgtaatgagagagagagagcaagagaaagagcaaacaattaaggagcagcagtggcttcctgcaggggagaccaatgccttctgtcctcagcggaaacagcttggcattcttccaattgatgaatggcatggaccaggagcactagttatcttcagcttctgagcatccgaataaataaacatacaaatgcataacataaaataaattcaaattacaaatgagaaaaccaatctaggttaccggcaagtcctatgacttgatgtggaggcctggaagtgcatccttgaatcttgcaatgcagtgagccaaggagcaatgagaggccacatgaataaccgggccagtgacaagacacatgtcctcctccttgctggtatacaccagaatgccccgcatgcagcgaatgctcaaaaagtgttggtggaagtgacagaattccatcaccattaaacacaaccagtgttgcggttgacaatggcactgaagcaggtgaaaaatccgtacagcagcttctgtctttgaagagtttgcagcctcttgaagagggtttagaggttaaaaaaaggacccaggctgatagggccgctaccatttggaaagtgacaagaggaagagagagaatgaaacaacagtaagcactggctctcagcttctacctgaagagacaaacattgctttcacttacatttcactggccaaatcaagcccatggcaacaattgagttcaaaagcataaggaggtatctggaaggaagagaatcagaaaatttctgatgagcctcactgactaccttcagggcaaaaaggaagagaggcactccagatcagagatctgcattggaaactccttgagaaccagaagggtatgctgtatttttgtaactgtgaggagcccagaaagactgaagcccaaataaaattcctttattcaatatt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]