GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:52:40, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NR_003716               2364 bp    RNA     linear   PRI 21-JUN-2020
DEFINITION  Homo sapiens HOX transcript antisense RNA (HOTAIR), transcript
            variant 2, long non-coding RNA.
ACCESSION   NR_003716
VERSION     NR_003716.3
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2364)
  AUTHORS   Zhao YH, Liu YL, Fei KL and Li P.
  TITLE     Long non-coding RNA HOTAIR modulates the progression of
            preeclampsia through inhibiting miR-106 in an EZH2-dependent manner
  JOURNAL   Life Sci. 253, 117668 (2020)
   PUBMED   32320706
  REMARK    GeneRIF: Long non-coding RNA HOTAIR modulates the progression of
            preeclampsia through inhibiting miR-106 in an EZH2-dependent manner
REFERENCE   2  (bases 1 to 2364)
  AUTHORS   Spokoini-Stern R, Stamov D, Jessel H, Aharoni L, Haschke H, Giron
            J, Unger R, Segal E, Abu-Horowitz A and Bachelet I.
  TITLE     Visualizing the structure and motion of the long noncoding RNA
            HOTAIR
  JOURNAL   RNA 26 (5), 629-636 (2020)
   PUBMED   32115425
  REMARK    GeneRIF: Our report provides a biologically plausible description
            of the anatomy and intrinsic properties of HOTAIR, and presents a
            framework for studying the structural biology of lncRNAs.
REFERENCE   3  (bases 1 to 2364)
  AUTHORS   Wasson CW, Abignano G, Hermes H, Malaab M, Ross RL, Jimenez SA,
            Chang HY, Feghali-Bostwick CA and Del Galdo F.
  TITLE     Long non-coding RNA HOTAIR drives EZH2-dependent myofibroblast
            activation in systemic sclerosis through miRNA 34a-dependent
            activation of NOTCH
  JOURNAL   Ann. Rheum. Dis. 79 (4), 507-517 (2020)
   PUBMED   32041748
  REMARK    GeneRIF: Data indicate that the EZH2-dependent epigenetic phenotype
            of myofibroblasts in systemic sclerosis is driven by HOTAIR and is
            linked to miRNA-34a repression-dependent activation of NOTCH
            signalling.
REFERENCE   4  (bases 1 to 2364)
  AUTHORS   Tao D, Zhang Z, Liu X, Zhang Z, Fu Y, Zhang P, Yuan H, Liu L, Cheng
            J and Jiang H.
  TITLE     LncRNA HOTAIR promotes the invasion and metastasis of oral squamous
            cell carcinoma through metastasis-associated gene 2
  JOURNAL   Mol. Carcinog. 59 (4), 353-364 (2020)
   PUBMED   31995261
  REMARK    GeneRIF: The HOX antisense intergenic RNA
            (HOTAIR)-miR-326-metastasis-associated gene 2 (MTA2) axis may
            contribute to a better understanding of oral squamous cell
            carcinoma (OSCC) pathogenesis and be a potential therapeutic target
            for OSCC.
REFERENCE   5  (bases 1 to 2364)
  AUTHORS   Volkohon AD, Kolnoguz AV, Chumachenko YD, Harbuzova VY and
            Tsyndrenko NL.
  TITLE     Association analysis between HOTAIR RS1899663 single nucleotide
            polymorphism and clear cell renal cell carcinoma development in
            Ukrainian population
  JOURNAL   Wiad. Lek. 73 (1), 12-16 (2020)
   PUBMED   32124799
  REMARK    GeneRIF: no association was found between HOTAIR
            rs1899663-polymorphic variant and clear cell renal cell carcinoma
            development in Ukrainian population.
REFERENCE   6  (bases 1 to 2364)
  AUTHORS   Tsai MC, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, Shi Y,
            Segal E and Chang HY.
  TITLE     Long noncoding RNA as modular scaffold of histone modification
            complexes
  JOURNAL   Science 329 (5992), 689-693 (2010)
   PUBMED   20616235
  REMARK    GeneRIF: findings show that the lincRNA HOTAIR serves as a scaffold
            for at least two distinct histone modification complexes; A 5'
            domain of HOTAIR binds polycomb repressive complex 2 (PRC2),
            whereas a 3' domain of HOTAIR binds the LSD1/CoREST/REST complex
REFERENCE   7  (bases 1 to 2364)
  AUTHORS   Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC,
            Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West
            RB, van de Vijver MJ, Sukumar S and Chang HY.
  TITLE     Long non-coding RNA HOTAIR reprograms chromatin state to promote
            cancer metastasis
  JOURNAL   Nature 464 (7291), 1071-1076 (2010)
   PUBMED   20393566
  REMARK    GeneRIF: The lincRNA termed HOTAIR is increased in expression in
            primary breast tumours and metastases, and HOTAIR expression level
            in primary tumours is a powerful predictor of eventual metastasis
            and death.
REFERENCE   8  (bases 1 to 2364)
  AUTHORS   Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D,
            Thomas K, Presser A, Bernstein BE, van Oudenaarden A, Regev A,
            Lander ES and Rinn JL.
  TITLE     Many human large intergenic noncoding RNAs associate with
            chromatin-modifying complexes and affect gene expression
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 106 (28), 11667-11672 (2009)
   PUBMED   19571010
REFERENCE   9  (bases 1 to 2364)
  AUTHORS   Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA,
            Goodnough LH, Helms JA, Farnham PJ, Segal E and Chang HY.
  TITLE     Functional demarcation of active and silent chromatin domains in
            human HOX loci by noncoding RNAs
  JOURNAL   Cell 129 (7), 1311-1323 (2007)
   PUBMED   17604720
REFERENCE   10 (bases 1 to 2364)
  AUTHORS   Woo CJ and Kingston RE.
  TITLE     HOTAIR lifts noncoding RNAs to new levels
  JOURNAL   Cell 129 (7), 1257-1259 (2007)
   PUBMED   17604716
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA905601.1, AK123741.1,
            AC012531.11 and AA399272.1.
            On Apr 5, 2012 this sequence version replaced NR_003716.2.
            
            Summary: This gene is located within the Homeobox C (HOXC) gene
            cluster on chromosome 12 and is co-expressed with the HOXC genes.
            It functions through an RNA product, which binds lysine specific
            demethylase 1 (LSD1) and Polycomb repressive complex 2 (PRC2), and
            serves as a scaffold to assemble these regulators at the HOXD gene
            cluster, thereby promoting epigenetic repression of HOXD. This gene
            is highly expressed in multiple tumors. Alternatively spliced
            transcript variants have been identified. [provided by RefSeq, Feb
            2019].
            
            Transcript Variant: This variant (2) has an additional exon in the
            3' region, compared to variant 1. Its 5' end has not been
            determined.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HG975398.1, DQ926657.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA2467144 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-187               DA905601.1         60-246
            188-696             AK123741.1         1-509
            697-2217            AC012531.11        100057-101577       c
            2218-2364           AA399272.1         1-147               c
FEATURES             Location/Qualifiers
     source          1..2364
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.13"
     gene            1..2364
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /note="HOX transcript antisense RNA"
                     /db_xref="GeneID:100124700"
                     /db_xref="HGNC:HGNC:33510"
                     /db_xref="MIM:611400"
     ncRNA           1..2364
                     /ncRNA_class="lncRNA"
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /product="HOX transcript antisense RNA, transcript variant
                     2"
                     /db_xref="GeneID:100124700"
                     /db_xref="HGNC:HGNC:33510"
                     /db_xref="MIM:611400"
     exon            1..140
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       10
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1343482934"
     variation       15
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918382727"
     variation       18
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973937487"
     variation       19
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212780552"
     variation       24
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000022974"
     variation       25
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748540504"
     variation       28
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902984322"
     variation       29
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439174192"
     variation       32
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306064006"
     variation       37
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367949505"
     variation       44
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222818557"
     variation       45
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548034593"
     variation       49
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318230854"
     variation       53
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567709233"
     variation       56
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014104080"
     variation       58
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467076531"
     variation       59
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298857007"
     variation       61
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195345858"
     variation       62
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895500914"
     variation       69
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055376129"
     variation       74
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219139761"
     variation       76
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779286783"
     variation       86
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532719220"
     variation       88
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888200177"
     variation       89
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768878421"
     variation       93
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955006633"
     variation       97
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325992702"
     variation       98
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235771740"
     variation       107
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441885167"
     variation       108
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277417318"
     variation       109
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73313155"
     variation       113
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292129413"
     variation       114
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332641018"
     variation       120
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930162795"
     variation       121
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988526299"
     variation       127
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437044161"
     variation       134
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202095733"
     variation       135
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041331363"
     variation       136
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439108082"
     variation       140
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911248229"
     exon            141..266
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       141
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565712233"
     variation       142
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1329546185"
     variation       147
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:953811310"
     variation       149
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234548857"
     variation       151
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1200608043"
     variation       153
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921022139"
     variation       155
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227119229"
     variation       158
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1270538548"
     variation       161
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185191474"
     variation       169
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:979166715"
     variation       170
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575388178"
     variation       171
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264901644"
     variation       173
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968635023"
     variation       189..192
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1373881181"
     variation       189
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031125648"
     variation       190
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999089999"
     variation       191
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968611548"
     variation       202
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021944010"
     variation       210
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1012804975"
     variation       211
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460485412"
     variation       213
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1360941798"
     variation       214
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894117487"
     variation       215
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388893739"
     variation       217
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592193641"
     variation       218
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192969443"
     variation       231
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303930872"
     variation       232
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592193633"
     variation       237
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035016253"
     variation       238..241
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1592193630"
     variation       239
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002532600"
     variation       244
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408008611"
     variation       245
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:905150341"
     variation       252
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897560525"
     variation       253
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1264016274"
     variation       258
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358089944"
     variation       265
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222809808"
     exon            267..368
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       269
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236730164"
     variation       276
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757175770"
     variation       282
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555670580"
     variation       287
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199493539"
     variation       296
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:916649958"
     variation       311
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251078152"
     variation       317..332
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ggggagtggggagtgg"
                     /replace="ggggagtggggagtggggagtgg"
                     /db_xref="dbSNP:1364195419"
     variation       320
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592193256"
     variation       327
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471555649"
     variation       330
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592193253"
     variation       332
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:990887196"
     variation       336
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987576454"
     variation       342
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337982628"
     variation       344
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954774061"
     variation       352
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534252584"
     variation       357
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996698437"
     variation       359
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:964177234"
     variation       360
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395117843"
     variation       361
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022229524"
     variation       367
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1166375692"
     exon            369..492
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       378
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044397783"
     variation       380
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469560725"
     variation       383..385
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:954658987"
     variation       392
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453760897"
     variation       395
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319537838"
     variation       404
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190087427"
     variation       407
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010887847"
     variation       422..432
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="gaccagaaatg"
                     /db_xref="dbSNP:1257025536"
     variation       431
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383452611"
     variation       432
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975206638"
     variation       436
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221647373"
     variation       443
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208959780"
     variation       447
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551007666"
     variation       450
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867620883"
     variation       466
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241814553"
     variation       468
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055104380"
     variation       474..475
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1010845288"
     variation       474
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188410313"
     variation       475
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939443294"
     variation       483
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480111840"
     variation       488
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956621629"
     variation       492
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529367168"
     exon            493..545
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       494
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:949614562"
     variation       495
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537377655"
     variation       500
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:922905327"
     variation       501
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237443447"
     variation       505
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564341635"
     variation       506
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287580672"
     variation       507
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488293817"
     variation       508
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201203822"
     variation       510
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267470164"
     variation       511..512
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aattaa"
                     /db_xref="dbSNP:60732492"
     variation       511
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="attaa"
                     /db_xref="dbSNP:67188582"
     variation       513..514
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="aatt"
                     /db_xref="dbSNP:143496128"
     variation       513
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200571747"
     variation       519
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453182417"
     variation       521
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976268564"
     variation       530
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192602"
     variation       531
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247562460"
     variation       532
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469842010"
     variation       534
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569819779"
     variation       538
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1157045174"
     variation       539
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1382256955"
     variation       540
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1420365901"
     variation       541
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163583440"
     exon            546..2362
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /inference="alignment:Splign:2.1.0"
     variation       547
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333033817"
     variation       548
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954591197"
     variation       549
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164939890"
     variation       551
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021265875"
     variation       552
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894551180"
     variation       555
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341702164"
     variation       558
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1009500773"
     variation       569
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1250674043"
     variation       570
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192529"
     variation       574
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183607878"
     variation       580
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893440759"
     variation       584
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017398932"
     variation       599..608
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="agagagag"
                     /replace="agagagagag"
                     /db_xref="dbSNP:1200046963"
     variation       605
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260288344"
     variation       606
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1053388018"
     variation       614
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536505412"
     variation       615
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192524"
     variation       616
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425573283"
     variation       618
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:904946081"
     variation       619
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428952127"
     variation       620
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565711253"
     variation       622
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046162992"
     variation       627
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423534587"
     variation       633
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247168509"
     variation       634
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949567501"
     variation       635
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908729786"
     variation       644
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:929197676"
     variation       648
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592192516"
     variation       650
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867710570"
     variation       653
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469709663"
     variation       656
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778772853"
     variation       657
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396099510"
     variation       658
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756827347"
     variation       660
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753712445"
     variation       668
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901530450"
     variation       672
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931583861"
     variation       676
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331693259"
     variation       677
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253717777"
     variation       688
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209261817"
     variation       693
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200062893"
     variation       696..698
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:869293596"
     variation       697
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:111434707"
     variation       697
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:763855108"
     variation       697
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17840857"
     variation       698..700
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:201299570"
     variation       701
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975401876"
     variation       705
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547139015"
     variation       706
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:942706628"
     variation       714
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191759592"
     variation       718
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912632199"
     variation       731
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1484316451"
     variation       739
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341984552"
     variation       745
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:990281857"
     variation       752..757
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1565711221"
     variation       758..761
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1487608632"
     variation       758..759
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1372303428"
     variation       758
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:187384923"
     variation       767
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196424288"
     variation       769
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592192481"
     variation       770
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424795327"
     variation       771
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432911935"
     variation       773
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565711206"
     variation       776..777
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1323683620"
     variation       777
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173596255"
     variation       779
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954670712"
     variation       780
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1466145508"
     variation       783
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358025452"
     variation       792
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020795065"
     variation       795
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1592192465"
     variation       804
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988424649"
     variation       806
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344704354"
     variation       818
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217260946"
     variation       819
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299517387"
     variation       826
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314143535"
     variation       835
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234177164"
     variation       838
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557438483"
     variation       842
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351519751"
     variation       844
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756103880"
     variation       845
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763629259"
     variation       846
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971616067"
     variation       850
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488399670"
     variation       861
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189831317"
     variation       870
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192446"
     variation       873
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192445"
     variation       874
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169346978"
     variation       877
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565711170"
     variation       878
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429994691"
     variation       879
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024758974"
     variation       881
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433417836"
     variation       882
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032257118"
     variation       884
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762563705"
     variation       885
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377973258"
     variation       886
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001814400"
     variation       890
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535935865"
     variation       891
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017039103"
     variation       892
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1349222122"
     variation       893
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192426"
     variation       894..896
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:951889973"
     variation       895
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005612419"
     variation       896..903
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="cggctcgg"
                     /replace="cggctcggctcgg"
                     /db_xref="dbSNP:1219927663"
     variation       897
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026136414"
     variation       898
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387592952"
     variation       901
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545965699"
     variation       902..903
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /replace="ctcc"
                     /db_xref="dbSNP:201948416"
     variation       902
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7958904"
     variation       903
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287439853"
     variation       904
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759916627"
     variation       908
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887233959"
     variation       913
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488984158"
     variation       917..923
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccacacc"
                     /replace="ccacaccacacc"
                     /db_xref="dbSNP:888749359"
     variation       918
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177678547"
     variation       919
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235944994"
     variation       921
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192395"
     variation       923
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252735419"
     variation       924
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441073401"
     variation       925
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054161080"
     variation       926
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196611429"
     variation       929
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935734380"
     variation       935
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350272625"
     variation       948
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924819030"
     variation       953
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047222833"
     variation       959
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1838169"
     variation       963..964
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:531203390"
     variation       967
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310090131"
     variation       976
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378482880"
     variation       977
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542209426"
     variation       981
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227130335"
     variation       984
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574785476"
     variation       991
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:553393371"
     variation       996
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315411296"
     variation       998
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60674771"
     variation       1006..1010
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:958748523"
     variation       1009
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040003410"
     variation       1010
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:942652708"
     variation       1015
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255824088"
     variation       1018
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912579640"
     variation       1024
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909862812"
     variation       1027
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330235164"
     variation       1030
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471493830"
     variation       1031
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987256220"
     variation       1032
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577388608"
     variation       1033
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:984230776"
     variation       1037
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369502915"
     variation       1046
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:74348153"
     variation       1047
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951440399"
     variation       1048
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946156788"
     variation       1049..1051
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1026187033"
     variation       1050..1060
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccgctcagccg"
                     /replace="ccgctcagccgctcagccg"
                     /db_xref="dbSNP:1191516592"
     variation       1052
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:913345903"
     variation       1056
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192336"
     variation       1058
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:993339142"
     variation       1059
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868156619"
     variation       1060
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1018874795"
     variation       1060
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141850773"
     variation       1062
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1007876110"
     variation       1063
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276702650"
     variation       1067
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171981971"
     variation       1070
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957896168"
     variation       1072
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032204756"
     variation       1074..1079
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1565711061"
     variation       1080
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192320"
     variation       1082
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:536808709"
     variation       1091
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277448355"
     variation       1092..1100
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="taatt"
                     /replace="taattaatt"
                     /db_xref="dbSNP:1237498650"
     variation       1093
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182560442"
     variation       1095
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:569944537"
     variation       1100
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773201616"
     variation       1106
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487925940"
     variation       1109
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1472406939"
     variation       1114
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1425538782"
     variation       1122
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249943809"
     variation       1127
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181740093"
     variation       1128
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486237833"
     variation       1129
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592192294"
     variation       1131
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192291"
     variation       1134
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1278358509"
     variation       1135
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199248163"
     variation       1136
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192285"
     variation       1137
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412896617"
     variation       1143
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536546782"
     variation       1144
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353395309"
     variation       1145
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192278"
     variation       1148
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377235669"
     variation       1155
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024643404"
     variation       1163
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399963842"
     variation       1164
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296832719"
     variation       1174
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280806267"
     variation       1175
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013707331"
     variation       1176
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192272"
     variation       1186
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373913062"
     variation       1194
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950262255"
     variation       1195
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280463879"
     variation       1199..1203
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1352275715"
     variation       1204
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546974474"
     variation       1210
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214424850"
     variation       1220
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349299764"
     variation       1223
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:917378331"
     variation       1229
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189376086"
     variation       1233
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995655370"
     variation       1239
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564610577"
     variation       1241
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244706446"
     variation       1242
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416226724"
     variation       1243
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056081367"
     variation       1244..1251
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aag"
                     /replace="aaggaaag"
                     /db_xref="dbSNP:1592192245"
     variation       1252
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359592266"
     variation       1253
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395791276"
     variation       1256
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17720428"
     variation       1257
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157422478"
     variation       1259
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039949207"
     variation       1265
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362996876"
     variation       1266
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401705657"
     variation       1272
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1592192226"
     variation       1276
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323320284"
     variation       1277
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412712583"
     variation       1280..1285
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ca"
                     /replace="caaaca"
                     /db_xref="dbSNP:1438203339"
     variation       1286
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565710983"
     variation       1287
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:530961052"
     variation       1292
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375572746"
     variation       1300
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237320952"
     variation       1309
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1288149388"
     variation       1313
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192215"
     variation       1314
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351326811"
     variation       1315
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209099344"
     variation       1323
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287504215"
     variation       1327
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:909925773"
     variation       1328
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12312094"
     variation       1330
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439233122"
     variation       1340
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176838793"
     variation       1341
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051101391"
     variation       1344
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:542198492"
     variation       1347
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409834772"
     variation       1348
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946073278"
     variation       1350
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:552406812"
     variation       1350
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:918678641"
     variation       1355
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530402572"
     variation       1359
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1407403780"
     variation       1368
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377691358"
     variation       1369
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054973538"
     variation       1373..1375
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:36075637"
     variation       1379
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1326250742"
     variation       1380
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184960732"
     variation       1384
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936486557"
     variation       1386
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192178"
     variation       1387
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449263047"
     variation       1391
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285618780"
     variation       1395
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986104662"
     variation       1404
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925132966"
     variation       1423
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192169"
     variation       1425
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244001226"
     variation       1426
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953406981"
     variation       1428
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577428774"
     variation       1434
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201059190"
     variation       1438
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592192161"
     variation       1439
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980614936"
     variation       1440
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192156"
     variation       1442
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:969273430"
     variation       1444
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274099645"
     variation       1447
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1327934059"
     variation       1448
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457491972"
     variation       1449
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032854056"
     variation       1451
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773650430"
     variation       1452
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234766735"
     variation       1456
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769579512"
     variation       1463
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020006991"
     variation       1465
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367232604"
     variation       1469
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474011970"
     variation       1470
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379385708"
     variation       1471
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423275180"
     variation       1476
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192133"
     variation       1484
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014410307"
     variation       1485
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143161957"
     variation       1498
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1025368737"
     variation       1501
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995267561"
     variation       1512
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543608618"
     variation       1515
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780157367"
     variation       1517
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770014270"
     variation       1528
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018457824"
     variation       1531
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342176687"
     variation       1535
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233757879"
     variation       1539
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192112"
     variation       1543
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1456637137"
     variation       1548
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315784541"
     variation       1549
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937642111"
     variation       1554
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386552179"
     variation       1557
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481039808"
     variation       1562
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199930403"
     variation       1564
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007104829"
     variation       1567
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1048639846"
     variation       1569
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192099"
     variation       1572
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189217352"
     variation       1578
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262948942"
     variation       1583
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477032746"
     variation       1585
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172421079"
     variation       1606
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929980330"
     variation       1607
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891370538"
     variation       1610
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161647261"
     variation       1611
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170306476"
     variation       1614
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192090"
     variation       1615
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745603728"
     variation       1617
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976884915"
     variation       1618
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192082"
     variation       1619
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297485089"
     variation       1624
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338200010"
     variation       1630
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1592192075"
     variation       1631
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1401614939"
     variation       1632
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:576206070"
     variation       1636
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298075397"
     variation       1645
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1476619679"
     variation       1650
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010222121"
     variation       1651
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:534309238"
     variation       1652
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308315511"
     variation       1658
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565710841"
     variation       1663
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891812143"
     variation       1669
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554742485"
     variation       1671
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139288906"
     variation       1682
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212286165"
     variation       1683
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944115356"
     variation       1701
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463880452"
     variation       1707
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1487549130"
     variation       1712
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911761187"
     variation       1716
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986377071"
     variation       1717
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245693827"
     variation       1718
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592192057"
     variation       1723
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1223080018"
     variation       1733
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262792108"
     variation       1734
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432236427"
     variation       1744
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:936097552"
     variation       1746
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592192050"
     variation       1747
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196252163"
     variation       1749
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396416026"
     variation       1751
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953175546"
     variation       1752
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927420453"
     variation       1755
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565619013"
     variation       1760
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145860004"
     variation       1765
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142098625"
     variation       1770
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:992503794"
     variation       1771
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366597313"
     variation       1778
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757226391"
     variation       1779
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537392970"
     variation       1782
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373336565"
     variation       1784
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895547985"
     variation       1794
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918254795"
     variation       1795
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1352163599"
     variation       1797
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218473289"
     variation       1801
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261709666"
     variation       1805
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1565710786"
     variation       1805
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:571012711"
     variation       1811
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207744928"
     variation       1812
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254493189"
     variation       1813
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328042506"
     variation       1817
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1177482763"
     variation       1817
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751492661"
     variation       1820
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437330587"
     variation       1832
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420841549"
     variation       1835
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:180939821"
     variation       1843
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349136360"
     variation       1845
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163014526"
     variation       1846
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456170251"
     variation       1848
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324215384"
     variation       1862
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396938683"
     variation       1866
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1048691635"
     variation       1870
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930191397"
     variation       1876
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018072426"
     variation       1878
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226029274"
     variation       1879
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168304186"
     variation       1880
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448240105"
     variation       1881
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1219814039"
     variation       1884
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571976806"
     variation       1899
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1468645201"
     variation       1900
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197577538"
     variation       1901
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955755349"
     variation       1907
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481314907"
     variation       1908
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177749242"
     variation       1910..1911
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1412972039"
     variation       1912
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029893766"
     variation       1918
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041432837"
     variation       1919
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166841389"
     variation       1928
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418216768"
     variation       1931
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462191032"
     variation       1935
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330872135"
     variation       1940
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757922994"
     variation       1946
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444461420"
     variation       1950
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299307304"
     variation       1956
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379104546"
     variation       1959..1966
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1335850402"
     variation       1965..1966
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:33918810"
     variation       1966..1967
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="ac"
                     /replace="c"
                     /replace="ctcagcagatggagattaccattcccaatagaaaaaaaac"
                     /db_xref="dbSNP:3839967"
     variation       1966..1967
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:869193878"
     variation       1966..1967
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="at"
                     /replace="c"
                     /db_xref="dbSNP:1555179144"
     variation       1966
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200349340"
     variation       1969
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911298009"
     variation       1970
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218937922"
     variation       1974
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:985538057"
     variation       1989
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752299278"
     variation       2002
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:3839968"
     variation       2002
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:779678471"
     variation       2002
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199717584"
     variation       2005
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257989884"
     variation       2008
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477356826"
     variation       2009
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170321747"
     variation       2012
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417626890"
     variation       2014
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305599084"
     variation       2019
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171228761"
     variation       2020
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358607991"
     variation       2025
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219723304"
     variation       2030..2031
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1413499618"
     variation       2032
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367073806"
     variation       2033..2037
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1291788494"
     variation       2044
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444652767"
     variation       2051
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764888962"
     variation       2055
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315327246"
     variation       2062
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356547994"
     variation       2065
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2366152"
     variation       2068
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307621641"
     variation       2069..2082
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="attt"
                     /replace="atttcaatgtattt"
                     /db_xref="dbSNP:1377643870"
     variation       2075
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268108497"
     variation       2076
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341054097"
     variation       2078
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1044481243"
     variation       2080
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214722122"
     variation       2082
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428280012"
     variation       2085
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560050858"
     variation       2086
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212994142"
     variation       2088
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912930772"
     variation       2090..2111
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="acacagtatgtatataaacaca"
                     /replace="acacagtatgtatataaacacagtatgtatataaacaca"
                     /db_xref="dbSNP:574452187"
     variation       2090
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487874849"
     variation       2091
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177510527"
     variation       2094
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1191258662"
     variation       2095
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541444610"
     variation       2098
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476531777"
     variation       2100
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187283078"
     variation       2101
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532504818"
     variation       2105
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424612552"
     variation       2108
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754219999"
     variation       2111
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432908759"
     variation       2117
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376579311"
     variation       2120
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866572114"
     variation       2122
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929884448"
     variation       2124
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:565281087"
     variation       2131
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473385455"
     variation       2136
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918547728"
     variation       2148
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766816108"
     variation       2158
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273853479"
     variation       2160
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203970931"
     variation       2167
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973726957"
     variation       2173
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745409441"
     variation       2174
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235837226"
     variation       2179
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001264122"
     variation       2181
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1592191842"
     variation       2182
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352909321"
     variation       2185
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761309417"
     variation       2187..2190
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1203270825"
     variation       2195
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773752738"
     variation       2197
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210730449"
     variation       2198
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985634864"
     variation       2200
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447344953"
     variation       2204
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543594797"
     variation       2215
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1311472860"
     variation       2218
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246340667"
     variation       2219
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452721105"
     variation       2224
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030253094"
     variation       2232
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195592745"
     variation       2240
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1395696310"
     variation       2242
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439651541"
     variation       2248
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772107865"
     variation       2250
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1157287769"
     variation       2259
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370220472"
     variation       2267
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989039856"
     variation       2277
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1391858425"
     variation       2278
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994453010"
     variation       2286
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375454291"
     variation       2290
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236852759"
     variation       2293
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281182840"
     variation       2295..2296
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="caagg"
                     /db_xref="dbSNP:1351214496"
     variation       2296
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553391907"
     variation       2298
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554496458"
     variation       2301
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761884512"
     variation       2309..2320
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="tgtgtgtgtg"
                     /replace="tgtgtgtgtgtg"
                     /replace="tgtgtgtgtgtgtg"
                     /db_xref="dbSNP:1008663091"
     variation       2312
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041260767"
     variation       2315
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566536199"
     variation       2324
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1215739843"
     variation       2328
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026705186"
     variation       2333..2341
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="ataaa"
                     /replace="ataaataaa"
                     /db_xref="dbSNP:879481932"
     regulatory      2336..2341
                     /regulatory_class="polyA_signal_sequence"
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
     variation       2336..2340
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:879919356"
     variation       2338..2343
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="t"
                     /replace="taaagt"
                     /db_xref="dbSNP:936741607"
     variation       2338
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:534879867"
     variation       2338
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111294925"
     variation       2340..2343
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="aagt"
                     /db_xref="dbSNP:552357611"
     variation       2342..2343
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:879383432"
     variation       2348
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137995449"
     variation       2349
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377657236"
     variation       2352
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905889573"
     variation       2354
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546692438"
     variation       2361
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014761939"
     polyA_site      2362
                     /gene="HOTAIR"
                     /gene_synonym="HOXAS; HOXC-AS4; HOXC11-AS1; NCRNA00072"
ORIGIN      
cctccaggccctgccttctgcctgcacattctgccctgatttccggaacctggaagcctaggcaggcagtggggaactctgactcgcctgtgctctggagcttgatccgaaagcttccacagtgaggactgctccgtgggggtaagagagcaccaggcactgaggcctgggagttccacagaccaacacccctgctcctggcggctcccacccgggacttagaccctcaggtccctaatatcccggaggtgctctcaatcagaaaggtcctgctccgcttcgcagtggaatggaacggatttagaagcctgcagtaggggagtggggagtggagagagggagcccagagttacagacggcggcgagaggaaggaggggcgtctttatttttttaaggccccaaagagtctgatgtttacaagaccagaaatgccacggccgcgtcctggcagagaaaaggctgaaatggaggaccggcgccttccttataagtatgcacattggcgagagaagtgctgcaacctaaaccagcaattacacccaagctcgttggggcctaagccagtaccgacctggtagaaaaagcaaccacgaagctagagagagagccagaggagggaagagagcgccagacgaaggtgaaagcgaaccacgcagagaaatgcaggcaagggagcaaggcggcagttcccggaacaaacgtggcagagggcaagacgggcactcacagacagaggtttatgtatttttattttttaaaatctgatttggtgttccatgaggaaaagggaaaatctagggaacgggagtacagagagaataatccgggtcctagctcgccacatgaacgcccagagaacgctggaaaaacctgagcgggtgccggggcagcacccggctcgggtcagccactgccccacaccgggcccaccaagccccgcccctcgcggccaccggggcttccttgctcttcttatcatctccatctttatgatgaggcttgttaacaagaccagagagctggccaagcacctctatctcagccgcgcccgctcagccgagcagcggtcggtggggggactgggaggcgctaattaattgattcctttggactgtaaaatatggcggcgtctacacggaacccatggactcataaacaatatatctgttgggcgtgagtgcactgtctctcaaataatttttccataggcaaatgtcagagggttctggatttttagttgctaaggaaagatccaaatgggaccaattttaggaggcccaaacagagtccgttcagtgtcagaaaatgcttccccaaaggggttgggagtgtgttttgttggaaaaaagcttgggttataggaaagcctttccctgctacttgtgtagacccagcccaatttaagaattacaaggaagcgaaggggttgtgtaggccggaagcctctctgtcccggctggatgcaggggacttgagctgctccggaatttgagaggaacatagaagcaaaggtccagcctttgcttcgtgctgattcctagacttaagattcaaaaacaaatttttaaaagtgaaaccagccctagcctttggaagctcttgaaggttcagcacccacccaggaatccacctgcctgttacacgcctctccaagacacagtggcaccgcttttctaactggcagcacagagcaactctataatatgcttatattaggtctagaagaatgcatcttgagacacatgggtaacctaattatataatgcttgttccatacaggagtgattatgcagtgggaccctgctgcaaacgggactttgcactctaaatatagaccccagcttgggacaaaagttgcagtagaaaaatagacataggagaacacttaaataagtgatgcatgtagacacagaaggggtatttaaaagacagaaataatagaagtacagaagaacagaaaaaaaatcagcagatggagattaccattcccaatgcctgaacttcctcctgctattaagattgctagagaattgtgtcttaaacagttcatgaacccagaagaatgcaatttcaatgtatttagtacacacacagtatgtatataaacacaactcacagaatatattttccatacattgggtaggtatgcactttgtgtatatataataatgtattttccatgcagttttaaaatgtagatatattaatatctggatgcattttctgtgcactggttttatatgccttatggagtatatactcacatgtagctaaatagactcaggactgcacattccttgtgtaggttgtgtgtgtgtggtggttttatgcataaataaagttttacatgtggtgaatataaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]