GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:54:56, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_003571               2366 bp    RNA     linear   PRI 24-MAY-2018
DEFINITION  Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 4
            pseudogene 1 (PIN4P1), non-coding RNA.
ACCESSION   NR_003571 NM_001080853 XM_001132226
VERSION     NR_003571.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2366)
  AUTHORS   Venter JC, Adams MD, Myers EW, Li PW, Mural RJ, Sutton GG, Smith
            HO, Yandell M, Evans CA, Holt RA, Gocayne JD, Amanatides P, Ballew
            RM, Huson DH, Wortman JR, Zhang Q, Kodira CD, Zheng XH, Chen L,
            Skupski M, Subramanian G, Thomas PD, Zhang J, Gabor Miklos GL,
            Nelson C, Broder S, Clark AG, Nadeau J, McKusick VA, Zinder N,
            Levine AJ, Roberts RJ, Simon M, Slayman C, Hunkapiller M, Bolanos
            R, Delcher A, Dew I, Fasulo D, Flanigan M, Florea L, Halpern A,
            Hannenhalli S, Kravitz S, Levy S, Mobarry C, Reinert K, Remington
            K, Abu-Threideh J, Beasley E, Biddick K, Bonazzi V, Brandon R,
            Cargill M, Chandramouliswaran I, Charlab R, Chaturvedi K, Deng Z,
            Di Francesco V, Dunn P, Eilbeck K, Evangelista C, Gabrielian AE,
            Gan W, Ge W, Gong F, Gu Z, Guan P, Heiman TJ, Higgins ME, Ji RR, Ke
            Z, Ketchum KA, Lai Z, Lei Y, Li Z, Li J, Liang Y, Lin X, Lu F,
            Merkulov GV, Milshina N, Moore HM, Naik AK, Narayan VA, Neelam B,
            Nusskern D, Rusch DB, Salzberg S, Shao W, Shue B, Sun J, Wang Z,
            Wang A, Wang X, Wang J, Wei M, Wides R, Xiao C, Yan C, Yao A, Ye J,
            Zhan M, Zhang W, Zhang H, Zhao Q, Zheng L, Zhong F, Zhong W, Zhu S,
            Zhao S, Gilbert D, Baumhueter S, Spier G, Carter C, Cravchik A,
            Woodage T, Ali F, An H, Awe A, Baldwin D, Baden H, Barnstead M,
            Barrow I, Beeson K, Busam D, Carver A, Center A, Cheng ML, Curry L,
            Danaher S, Davenport L, Desilets R, Dietz S, Dodson K, Doup L,
            Ferriera S, Garg N, Gluecksmann A, Hart B, Haynes J, Haynes C,
            Heiner C, Hladun S, Hostin D, Houck J, Howland T, Ibegwam C,
            Johnson J, Kalush F, Kline L, Koduru S, Love A, Mann F, May D,
            McCawley S, McIntosh T, McMullen I, Moy M, Moy L, Murphy B, Nelson
            K, Pfannkoch C, Pratts E, Puri V, Qureshi H, Reardon M, Rodriguez
            R, Rogers YH, Romblad D, Ruhfel B, Scott R, Sitter C, Smallwood M,
            Stewart E, Strong R, Suh E, Thomas R, Tint NN, Tse S, Vech C, Wang
            G, Wetter J, Williams S, Williams M, Windsor S, Winn-Deen E, Wolfe
            K, Zaveri J, Zaveri K, Abril JF, Guigo R, Campbell MJ, Sjolander
            KV, Karlak B, Kejariwal A, Mi H, Lazareva B, Hatton T, Narechania
            A, Diemer K, Muruganujan A, Guo N, Sato S, Bafna V, Istrail S,
            Lippert R, Schwartz R, Walenz B, Yooseph S, Allen D, Basu A,
            Baxendale J, Blick L, Caminha M, Carnes-Stine J, Caulk P, Chiang
            YH, Coyne M, Dahlke C, Mays A, Dombroski M, Donnelly M, Ely D,
            Esparham S, Fosler C, Gire H, Glanowski S, Glasser K, Glodek A,
            Gorokhov M, Graham K, Gropman B, Harris M, Heil J, Henderson S,
            Hoover J, Jennings D, Jordan C, Jordan J, Kasha J, Kagan L, Kraft
            C, Levitsky A, Lewis M, Liu X, Lopez J, Ma D, Majoros W, McDaniel
            J, Murphy S, Newman M, Nguyen T, Nguyen N, Nodell M, Pan S, Peck J,
            Peterson M, Rowe W, Sanders R, Scott J, Simpson M, Smith T, Sprague
            A, Stockwell T, Turner R, Venter E, Wang M, Wen M, Wu D, Wu M, Xia
            A, Zandieh A and Zhu X.
  TITLE     The sequence of the human genome
  JOURNAL   Science 291 (5507), 1304-1351 (2001)
   PUBMED   11181995
  REMARK    Erratum:[Science 2001 Jun 5;292(5523):1838]
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AC023356.8.
            On Jun 14, 2007 this sequence version replaced NM_001080853.2.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AK055299.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2366              AC023356.8         77650-80015         c
FEATURES             Location/Qualifiers
     source          1..2366
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q15.3"
     gene            1..2366
                     /gene="PIN4P1"
                     /note="peptidylprolyl cis/trans isomerase,
                     NIMA-interacting 4 pseudogene 1"
                     /pseudo
                     /db_xref="GeneID:728758"
                     /db_xref="HGNC:HGNC:44193"
     misc_RNA        1..2366
                     /gene="PIN4P1"
                     /product="peptidylprolyl cis/trans isomerase,
                     NIMA-interacting 4 pseudogene 1"
                     /pseudo
                     /db_xref="GeneID:728758"
                     /db_xref="HGNC:HGNC:44193"
     exon            1..2366
                     /gene="PIN4P1"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       7
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934482138"
     variation       12
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866895989"
     variation       13
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772123821"
     variation       18
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562878065"
     variation       29
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271154350"
     variation       30
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1356009907"
     variation       40
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1030033078"
     variation       44
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1567204359"
     variation       47
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925785948"
     variation       50
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879262346"
     variation       52
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1174184736"
     variation       53
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995972972"
     variation       68
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552653914"
     variation       69
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372256895"
     variation       70
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180168197"
     variation       71
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1480731910"
     variation       78
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769163669"
     variation       81
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970417610"
     variation       85
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181611393"
     variation       86
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1161224182"
     variation       94
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415566073"
     variation       100
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281737383"
     variation       101
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240025477"
     variation       103
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358010492"
     variation       106
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352009792"
     variation       115
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422067743"
     variation       121
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992523210"
     variation       122
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340383468"
     variation       123
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759676913"
     variation       135
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560671748"
     variation       141
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383839480"
     variation       143
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239631433"
     variation       147
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283988971"
     variation       148
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540352101"
     variation       150..155
                     /gene="PIN4P1"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1567204260"
     variation       161
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188800448"
     variation       166
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205784126"
     variation       168..174
                     /gene="PIN4P1"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1378647819"
     variation       171
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224560527"
     variation       175
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244698756"
     variation       177
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149030228"
     variation       178
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047557899"
     variation       181
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177552074"
     variation       183
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541730645"
     variation       186
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378094024"
     variation       188
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774776053"
     variation       193
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1567204213"
     variation       203
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950880629"
     variation       217
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1028242286"
     variation       221
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158617452"
     variation       228
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402168541"
     variation       231
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995091138"
     variation       236
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1413223456"
     variation       238
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336580180"
     variation       239..254
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="catggtttccaggaac"
                     /db_xref="dbSNP:1313460902"
     variation       239
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450378684"
     variation       251
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771484672"
     variation       254
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038990137"
     variation       257
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418989083"
     variation       260
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:563827189"
     variation       265
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274294772"
     variation       270
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186287313"
     variation       271
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137938871"
     variation       274..275
                     /gene="PIN4P1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1198606603"
     variation       276..279
                     /gene="PIN4P1"
                     /replace=""
                     /replace="aata"
                     /db_xref="dbSNP:1197767654"
     variation       276
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749760310"
     variation       278
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461655031"
     variation       284
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1236032589"
     variation       294
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536665224"
     variation       303
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934743292"
     variation       311
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925804830"
     variation       312
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146953674"
     variation       323
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948653002"
     variation       325
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:12906333"
     variation       327
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770100494"
     variation       341
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430600700"
     variation       354
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541787564"
     variation       356
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465484283"
     variation       360
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:914157787"
     variation       362
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402776960"
     variation       376
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1392134217"
     variation       385
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322992642"
     variation       388
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987051740"
     variation       397
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235513463"
     variation       400
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955528876"
     variation       401
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568651712"
     variation       413
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747784587"
     variation       414
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255873353"
     variation       419
                     /gene="PIN4P1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1195959012"
     variation       419
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:959667900"
     variation       425
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:964509900"
     variation       427
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016312494"
     variation       436
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1449438557"
     variation       440
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200940258"
     variation       441
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216874222"
     variation       443
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1270290524"
     variation       463
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1321497115"
     variation       466
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:548450163"
     variation       472
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1310923962"
     variation       473..499
                     /gene="PIN4P1"
                     /replace="aatacagctaagactatgaggagcttc"
                     /replace="aatacagctaagactatgaggagcttcaatacagctaagactatgagg
                     agcttc"
                     /db_xref="dbSNP:1356221714"
     variation       477
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1230219568"
     variation       490
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169018414"
     variation       502..504
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1277601076"
     variation       509
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368881887"
     variation       510
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047672823"
     variation       512
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013539173"
     variation       514
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550384531"
     variation       522
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538538827"
     variation       531
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303804115"
     variation       534
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454170720"
     variation       536
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77588112"
     variation       538
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115948247"
     variation       539
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528923568"
     variation       543
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964865304"
     variation       544
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017781043"
     variation       545
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224118535"
     variation       549
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009111213"
     variation       550
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:867088412"
     variation       552
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192051503"
     variation       554
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1264477034"
     variation       555
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945376064"
     variation       556
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557323009"
     variation       560
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053567230"
     variation       571
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366983051"
     variation       572
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998940578"
     variation       574..576
                     /gene="PIN4P1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:986999077"
     variation       582
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164319664"
     variation       586
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:955642449"
     variation       611
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921406770"
     variation       614
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:904635550"
     variation       625..626
                     /gene="PIN4P1"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1363970151"
     variation       629
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:33986791"
     variation       632
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311704001"
     variation       641
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948513001"
     variation       644
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915763196"
     variation       646
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291881333"
     variation       649
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352432265"
     variation       650
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984575488"
     variation       662..665
                     /gene="PIN4P1"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1486462788"
     variation       662
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370519466"
     variation       667
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938585000"
     variation       675..680
                     /gene="PIN4P1"
                     /replace="agacag"
                     /replace="agacagacag"
                     /db_xref="dbSNP:1184368987"
     variation       678
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75505882"
     variation       679..680
                     /gene="PIN4P1"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1446686070"
     variation       679
                     /gene="PIN4P1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1257509908"
     variation       682..683
                     /gene="PIN4P1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1567203768"
     variation       683
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379912975"
     variation       687
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437967009"
     variation       704
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1567203757"
     variation       710
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216948537"
     variation       713
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161347216"
     variation       715
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982883326"
     variation       717
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:896417233"
     variation       720
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033895298"
     variation       721
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931058906"
     variation       724
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226577552"
     variation       730
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454377526"
     variation       736
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919643904"
     variation       737
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539797323"
     variation       743
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975200796"
     variation       751
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237376799"
     variation       752
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382678453"
     variation       753..758
                     /gene="PIN4P1"
                     /replace="acac"
                     /replace="acacac"
                     /db_xref="dbSNP:1291521550"
     variation       757
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308471583"
     variation       758
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903723758"
     variation       760
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442662629"
     variation       777
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043809714"
     variation       780
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:4924725"
     variation       783..787
                     /gene="PIN4P1"
                     /replace="tt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1204695214"
     variation       789..795
                     /gene="PIN4P1"
                     /replace="agaga"
                     /replace="agagaga"
                     /db_xref="dbSNP:1169516035"
     variation       799
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456582787"
     variation       805
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1179054965"
     variation       821
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113539845"
     variation       828
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374273698"
     variation       829..834
                     /gene="PIN4P1"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:569797545"
     variation       829
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1567203684"
     variation       832
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017730026"
     variation       833
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:1491448681"
     variation       834
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470864063"
     variation       835
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399132534"
     variation       839
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299399370"
     variation       840
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1433075604"
     variation       841
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987679066"
     variation       845
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56742095"
     variation       850
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195826665"
     variation       853
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921531197"
     variation       858
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281995482"
     variation       863
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:976111896"
     variation       867
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326249895"
     variation       869
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031659920"
     variation       870..875
                     /gene="PIN4P1"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1237864996"
     variation       874
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469184949"
     variation       881..882
                     /gene="PIN4P1"
                     /replace="at"
                     /replace="ta"
                     /db_xref="dbSNP:386783521"
     variation       881
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:541667809"
     variation       882
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:575823260"
     variation       890
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1567203641"
     variation       895
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189531288"
     variation       898
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984521452"
     variation       905
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116449597"
     variation       912
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176914657"
     variation       913
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754533058"
     variation       915
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422583775"
     variation       922
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1228091355"
     variation       926
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025957469"
     variation       928
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172169013"
     variation       935
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:894277296"
     variation       948
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298923279"
     variation       953
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442920506"
     variation       955
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300706656"
     variation       965
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057029204"
     variation       967
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347967021"
     variation       968
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960868101"
     variation       971
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277976771"
     variation       974
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938573743"
     variation       975..976
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1216679156"
     variation       992
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274045091"
     variation       1002
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:887046554"
     variation       1003
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002564333"
     variation       1005
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293981194"
     variation       1006
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1330324475"
     variation       1015
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490824769"
     variation       1016
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:903670972"
     variation       1019
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262380766"
     variation       1022
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1444084078"
     variation       1028
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188022565"
     variation       1032
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419839168"
     variation       1036
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1567203559"
     variation       1048
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404349061"
     variation       1052
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022105098"
     variation       1054
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046990741"
     variation       1059
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425848239"
     variation       1062
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930942703"
     variation       1065
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746528203"
     variation       1066
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009581871"
     variation       1069
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:975092505"
     variation       1071
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1051008239"
     variation       1075
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780875517"
     variation       1086
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378750234"
     variation       1090
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243979418"
     variation       1091
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933992396"
     variation       1094
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360345074"
     variation       1098
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942492293"
     variation       1105
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545670245"
     variation       1106
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445179121"
     variation       1107
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987626843"
     variation       1108
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242431950"
     variation       1109..1118
                     /gene="PIN4P1"
                     /replace="ctcact"
                     /replace="ctcactcact"
                     /db_xref="dbSNP:1386697672"
     variation       1112
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954941085"
     variation       1115
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1181296211"
     variation       1119
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032317709"
     variation       1122
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866174794"
     variation       1125
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:576792997"
     variation       1135
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566589246"
     variation       1139
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157500501"
     variation       1147
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982962622"
     variation       1152..1159
                     /gene="PIN4P1"
                     /replace="gtt"
                     /replace="gttcagtt"
                     /db_xref="dbSNP:919012218"
     variation       1152
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969092268"
     variation       1157
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402903500"
     variation       1159
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929006438"
     variation       1160..1164
                     /gene="PIN4P1"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1383768948"
     variation       1160
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1450909320"
     variation       1161
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339007533"
     variation       1164
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177034561"
     variation       1165
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553453456"
     variation       1171
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439724120"
     variation       1173
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225333198"
     variation       1175
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991946893"
     variation       1179
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779803477"
     variation       1186
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758387606"
     variation       1191
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1201517804"
     variation       1192
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960395017"
     variation       1205
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180501045"
     variation       1206..1216
                     /gene="PIN4P1"
                     /replace="tg"
                     /replace="tgagaaccttg"
                     /db_xref="dbSNP:564618985"
     variation       1206
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251346816"
     variation       1207
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546336040"
     variation       1216
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894599698"
     variation       1220
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750363640"
     variation       1223
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425067757"
     variation       1224
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1468613890"
     variation       1226..1227
                     /gene="PIN4P1"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1254242731"
     variation       1227
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1567203387"
     variation       1230
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002682449"
     variation       1232
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236380903"
     variation       1237
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348376872"
     variation       1245
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:149812776"
     variation       1247
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1337542572"
     variation       1256
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443013453"
     variation       1259
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022054230"
     variation       1265
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1567203370"
     variation       1268
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574400714"
     variation       1284
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047385825"
     variation       1288
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931248528"
     variation       1289
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:956579606"
     variation       1292
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337102248"
     variation       1293
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575729473"
     variation       1295
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557493227"
     variation       1296
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898151975"
     variation       1297
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78227853"
     variation       1301
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439107340"
     variation       1303
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141049273"
     variation       1307
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151114353"
     variation       1310
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1567203338"
     variation       1322
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912335641"
     variation       1323
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050820555"
     variation       1324
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933455847"
     variation       1325
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1465300603"
     variation       1328
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166435958"
     variation       1334
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398887577"
     variation       1344
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924812711"
     variation       1346
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040128973"
     variation       1357
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322931963"
     variation       1359
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360308653"
     variation       1360
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344833463"
     variation       1367
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157168580"
     variation       1369
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471280667"
     variation       1375
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345988150"
     variation       1376
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226405250"
     variation       1383
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1249311214"
     variation       1392
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978039811"
     variation       1395
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005773317"
     variation       1400
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364663461"
     variation       1403
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195902884"
     variation       1410
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181729286"
     variation       1411
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490005621"
     variation       1413
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422191514"
     variation       1414
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047223368"
     variation       1417
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428349413"
     variation       1419
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539304996"
     variation       1422
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189358491"
     variation       1427
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375036758"
     variation       1428
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:917455338"
     variation       1429
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163027645"
     variation       1433
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363720803"
     variation       1436
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212976409"
     variation       1439
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991518933"
     variation       1441..1448
                     /gene="PIN4P1"
                     /replace="agagag"
                     /replace="agagagag"
                     /db_xref="dbSNP:1381478577"
     variation       1441
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485931143"
     variation       1444
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285059973"
     variation       1445
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767729394"
     variation       1446
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056213753"
     variation       1451
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035747608"
     variation       1459
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327851155"
     variation       1464
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227626331"
     variation       1466
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939121293"
     variation       1469..1471
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1356726069"
     variation       1476
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224051199"
     variation       1484
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1002964075"
     variation       1488
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926283291"
     variation       1489
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759556152"
     variation       1501
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279821593"
     variation       1504
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203782213"
     variation       1506
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967955809"
     variation       1507
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1429347638"
     variation       1515
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915158025"
     variation       1519
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1159224677"
     variation       1536
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774437612"
     variation       1548
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1025514473"
     variation       1554
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:546630568"
     variation       1558
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143000729"
     variation       1561
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116503842"
     variation       1566
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:898440111"
     variation       1568
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164262166"
     variation       1572
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:117353643"
     variation       1574
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1452906615"
     variation       1582
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766756989"
     variation       1583
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296879025"
     variation       1592
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006489049"
     variation       1595
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335738927"
     variation       1607
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402870866"
     variation       1612
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998258113"
     variation       1614..1627
                     /gene="PIN4P1"
                     /replace=""
                     /replace="tattccccttctcc"
                     /db_xref="dbSNP:1162931706"
     variation       1616
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763486113"
     variation       1618..1621
                     /gene="PIN4P1"
                     /replace="ccc"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1247577278"
     variation       1623
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316861214"
     variation       1627
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237437217"
     variation       1628
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263013992"
     variation       1638..1643
                     /gene="PIN4P1"
                     /replace="ct"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:371903009"
     variation       1645..1652
                     /gene="PIN4P1"
                     /replace=""
                     /replace="ttattaaa"
                     /db_xref="dbSNP:1420145243"
     variation       1645
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050768110"
     variation       1650..1654
                     /gene="PIN4P1"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1462791274"
     variation       1659
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184312461"
     variation       1660
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773645740"
     variation       1669
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1418435827"
     variation       1671
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1188679539"
     variation       1672
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1567203115"
     variation       1674
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1005969800"
     variation       1679
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935100401"
     variation       1692..1693
                     /gene="PIN4P1"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1175403103"
     variation       1710
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888487143"
     variation       1731
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924773926"
     variation       1732
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041925050"
     variation       1734
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:947615391"
     variation       1739
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047335716"
     variation       1742
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458310563"
     variation       1749
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372069492"
     variation       1759
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:550644883"
     variation       1763
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309849682"
     variation       1766
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75837427"
     variation       1772
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991752166"
     variation       1782
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261603696"
     variation       1786
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325940214"
     variation       1805
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1208892728"
     variation       1811
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562313933"
     variation       1818
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762892357"
     variation       1826
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545705227"
     variation       1827
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479732094"
     variation       1830
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532265024"
     variation       1833
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770184936"
     variation       1835
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958658489"
     variation       1848
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233435031"
     variation       1853
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198439522"
     variation       1855
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316730369"
     variation       1861
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426861881"
     variation       1863
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928620182"
     variation       1866
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268986576"
     variation       1876
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763781986"
     variation       1880
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748592713"
     variation       1881
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353541216"
     variation       1884
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752632495"
     variation       1890
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981930180"
     variation       1895..1901
                     /gene="PIN4P1"
                     /replace=""
                     /replace="ccagagt"
                     /db_xref="dbSNP:1299348681"
     variation       1897
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:560093841"
     variation       1900
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12442297"
     variation       1902
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327423068"
     variation       1903
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404811978"
     variation       1907
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323254233"
     variation       1910
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385325445"
     variation       1932
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139491002"
     variation       1933
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554735603"
     variation       1937..1944
                     /gene="PIN4P1"
                     /replace="aaa"
                     /replace="aaaggaaa"
                     /db_xref="dbSNP:1305952939"
     variation       1938
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1220164044"
     variation       1942..1946
                     /gene="PIN4P1"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:946380105"
     variation       1942
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1465211209"
     variation       1944
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272625792"
     variation       1947
                     /gene="PIN4P1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1166116940"
     variation       1947
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206751027"
     variation       1950
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962881993"
     variation       1952
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242497756"
     variation       1957..1960
                     /gene="PIN4P1"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1481325974"
     variation       1960
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018120379"
     variation       1962
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746474755"
     variation       1963
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006769949"
     variation       1966
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466964358"
     variation       1968
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146312339"
     variation       1969
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1171919651"
     variation       1970..1974
                     /gene="PIN4P1"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1301895776"
     variation       1971
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988003190"
     variation       1974
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1423445851"
     variation       1975
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:879134901"
     variation       1976
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575926633"
     variation       1977
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050759775"
     variation       1978
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1360154300"
     variation       1982
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213910376"
     variation       1985
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216481344"
     variation       1989
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559155917"
     variation       1994
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358889460"
     variation       2004
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999677309"
     variation       2008
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902290796"
     variation       2012
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1316801323"
     variation       2014
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539322559"
     variation       2018
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289561376"
     variation       2028
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490809695"
     variation       2035
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042262035"
     variation       2039
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222061758"
     variation       2041
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947549219"
     variation       2042
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779581541"
     variation       2044
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484689531"
     variation       2049
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270230997"
     variation       2053
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1390384405"
     variation       2059
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443534193"
     variation       2061..2063
                     /gene="PIN4P1"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:922412266"
     variation       2062
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:878875445"
     variation       2063
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216854758"
     variation       2064..2068
                     /gene="PIN4P1"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:976999838"
     variation       2064
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893315650"
     variation       2076
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754337278"
     variation       2081
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343871717"
     variation       2088..2089
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1274637135"
     variation       2095
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321523560"
     variation       2098
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375846572"
     variation       2109
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018773028"
     variation       2110
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317192799"
     variation       2116
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358400588"
     variation       2126..2129
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="gtgg"
                     /db_xref="dbSNP:1248302207"
     variation       2126
                     /gene="PIN4P1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1373632188"
     variation       2126
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984254875"
     variation       2127
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314966260"
     variation       2128..2129
                     /gene="PIN4P1"
                     /replace=""
                     /replace="gg"
                     /db_xref="dbSNP:1446270326"
     variation       2128
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326874793"
     variation       2130..2131
                     /gene="PIN4P1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1398228327"
     variation       2131
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181238378"
     variation       2132
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:878872791"
     variation       2136
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025674254"
     variation       2137
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:878996051"
     variation       2162..2166
                     /gene="PIN4P1"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:1160316495"
     variation       2165
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402852433"
     variation       2167
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879222258"
     variation       2168
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530014409"
     variation       2168
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1330910737"
     variation       2169
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:878954016"
     variation       2172
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1338782860"
     variation       2174
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1341210760"
     variation       2177
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184424372"
     variation       2185
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420215724"
     variation       2186
                     /gene="PIN4P1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1348415569"
     variation       2193
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035826233"
     variation       2195
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002110828"
     variation       2197
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778781823"
     variation       2200
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:981493004"
     variation       2202
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536284238"
     variation       2209
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322416348"
     variation       2214
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:930033169"
     variation       2217
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906067197"
     variation       2221
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442544491"
     variation       2226
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:118074011"
     variation       2227
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231708033"
     variation       2234
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:878976721"
     variation       2240
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457006452"
     variation       2241
                     /gene="PIN4P1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962485704"
     variation       2244
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143606979"
     variation       2254
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178921493"
     variation       2255
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403149509"
     variation       2262..2273
                     /gene="PIN4P1"
                     /replace="cag"
                     /replace="cagacccagcag"
                     /db_xref="dbSNP:1333930809"
     variation       2262
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409491500"
     variation       2267
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760877318"
     variation       2270
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955326737"
     variation       2273
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205924428"
     variation       2280
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411519741"
     variation       2284
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1288751717"
     variation       2290
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935216401"
     variation       2291
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1221443018"
     variation       2293
                     /gene="PIN4P1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029732295"
     variation       2294
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:999226277"
     variation       2295
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:902188388"
     variation       2296..2304
                     /gene="PIN4P1"
                     /replace="tattat"
                     /replace="tattattat"
                     /db_xref="dbSNP:922514422"
     variation       2309..2316
                     /gene="PIN4P1"
                     /replace="gaag"
                     /replace="gaaggaag"
                     /db_xref="dbSNP:1194760984"
     variation       2312..2313
                     /gene="PIN4P1"
                     /replace=""
                     /replace="gg"
                     /db_xref="dbSNP:1209315443"
     variation       2313
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278610597"
     variation       2316
                     /gene="PIN4P1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1555465736"
     variation       2316
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879096491"
     variation       2318..2324
                     /gene="PIN4P1"
                     /replace="aaa"
                     /replace="aaataaa"
                     /db_xref="dbSNP:1371371145"
     variation       2320
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270205783"
     variation       2321
                     /gene="PIN4P1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1239711275"
     variation       2321
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:879169999"
     variation       2325..2333
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="atcatatga"
                     /db_xref="dbSNP:1377073005"
     variation       2326..2332
                     /gene="PIN4P1"
                     /replace=""
                     /replace="tcatatg"
                     /db_xref="dbSNP:1189300591"
     variation       2326..2327
                     /gene="PIN4P1"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:1443093185"
     variation       2327
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281482213"
     variation       2328
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1268779398"
     variation       2329
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358626614"
     variation       2330
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976736368"
     variation       2331
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312244593"
     variation       2332
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432744095"
     variation       2334
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1479686887"
     variation       2336..2340
                     /gene="PIN4P1"
                     /replace=""
                     /replace="gactg"
                     /db_xref="dbSNP:1467286163"
     variation       2336
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173973552"
     variation       2337
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378458789"
     variation       2339..2340
                     /gene="PIN4P1"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1475180007"
     variation       2339
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1344180391"
     variation       2340
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156324498"
     variation       2344..2345
                     /gene="PIN4P1"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:59125307"
     variation       2344
                     /gene="PIN4P1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:367918994"
     variation       2344
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201111977"
     variation       2345..2356
                     /gene="PIN4P1"
                     /replace="aaaaaaaaaaaa"
                     /replace="aaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
                     aa"
                     /db_xref="dbSNP:1567202579"
     variation       2345
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942519571"
     variation       2346..2350
                     /gene="PIN4P1"
                     /replace="aaaaa"
                     /replace="aaaaagaaaaa"
                     /db_xref="dbSNP:1402906957"
     variation       2349..2350
                     /gene="PIN4P1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:535006682"
     variation       2349
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178565019"
     variation       2350
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022008882"
     variation       2351..2356
                     /gene="PIN4P1"
                     /replace="aaaaaa"
                     /replace="aaaaaacaaaaaa"
                     /db_xref="dbSNP:1567202571"
     variation       2351..2352
                     /gene="PIN4P1"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:1236340285"
     variation       2351
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470243220"
     variation       2354
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331345307"
     variation       2355
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226159034"
     variation       2356..2362
                     /gene="PIN4P1"
                     /replace="aaaaaaa"
                     /replace="aaaaaaacaaaaaaa"
                     /db_xref="dbSNP:1446640658"
     variation       2357..2359
                     /gene="PIN4P1"
                     /replace="aaa"
                     /replace="caaaaaaaaac"
                     /db_xref="dbSNP:796522665"
     variation       2357
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868633489"
     variation       2358..2359
                     /gene="PIN4P1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1228462494"
     variation       2358
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:893304444"
     variation       2359..2360
                     /gene="PIN4P1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:201864727"
     variation       2359
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:866882530"
     variation       2360..2366
                     /gene="PIN4P1"
                     /replace="aaaaaaa"
                     /replace="aaaaaaacaaaaaaa"
                     /db_xref="dbSNP:1491428406"
     variation       2360..2365
                     /gene="PIN4P1"
                     /replace="aaaaaa"
                     /replace="aaaaaacaaaaaa"
                     /db_xref="dbSNP:1286670017"
     variation       2360..2364
                     /gene="PIN4P1"
                     /replace="aaaaa"
                     /replace="aaaaacaaaaa"
                     /db_xref="dbSNP:374698927"
     variation       2360..2363
                     /gene="PIN4P1"
                     /replace="aaaa"
                     /replace="aaaacaaaa"
                     /db_xref="dbSNP:1315486965"
     variation       2360..2362
                     /gene="PIN4P1"
                     /replace="aaa"
                     /replace="aaacaaa"
                     /db_xref="dbSNP:1567202536"
     variation       2360
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="acaaaaaca"
                     /db_xref="dbSNP:1216425593"
     variation       2361
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1268423158"
     variation       2362
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1429964320"
     variation       2363
                     /gene="PIN4P1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:911086253"
ORIGIN      
aattagctaggcgtggtggcacatgcctgtagtcccagctactcaggaggctgaggtgggaggatcacctgagcctgggaggtcgaggctgcagtgagccgtgattgtaccactgcactccagtctaggcaatggagtaagactgtctcaaaaaactaaagaactttaaaaaaattataacaaaatgatgctgaagaaaacattggaggacctgctgtaacatcatttggcttaaagtcatggtttccaggaacctgttgacaacatgaggacttaatagatatgatcagcaggatcatgaactagaaagcggcttggattctatccttggttttgccattaactgccaaccacatgacttcagataacctcttgccctcactaccttgtggagttactgaaagataaaatcaaagtgctttaaaaagatgaaagcattatacaaatttaagattttagcacagggacaaaaaatacagctaagactatgaggagcttctgaaagcagagattgagagctgtggcaaatatatgagccgtgacgcaatggggagcgtaactagatggcaggtgccctgcctttgcccccaccctctctccccattgtcctactcattcataacccagattccagggctcattcctctggagaatccttaactgtgcctgtgccaagacaggctccacaaggctggtcaggcaggctgcctgggtgcaaacggccaagccatgagggagccaaggaagatgggacacactgcttctgaaaggttactaacacctttttaagagagacctttggactgcttcatgtcctggaagaaggggaaaaaagagaccctttgggcttctggagctagccctgaaccaaaaaactccctaatcaacctgacttaggtaaaacctttactgagctgggaatctggttcagtctgggattgtcagggactatttcagggcaacagaaggggactggcttttcttgtcataggtcacaaaggcagagagaaccacaccagcatcaccaagatggccaggagtggaaaatgcagacattgagcctaaaacaagaagccatttccttgggagcactgtgatgggggccgcgctcactcactatatgcccaaagcctctggcctgggtggctgctgttcagttgagagtgtaaccagctcctgttttccctgccagggcttgagtcctgtgagaaccttgggaagagagaagagataatgggtagttttaggggatagaataccccttcctcctaccaaatgtaagagaaatccacccccgcaacaagatcttctcaaactgttttgtgctctgaagtgtctaaagataggggagcttttcagcctattctagacccagctccttctcagaggaaaagagagggagctggccagggactactcccatgccccctcaagaagagcagagagagtttctaccccatcattccacaaagtcagaacagctagaacggaggctgaagagactgagagcagctgcagaaatccaaaaatattgaccttataagctcaagatgctgtatgctgggtttttacaaggatattcggtatttgatgaaacccagttaggcatgacatattccccttctccccattcctacctctcttttattaaaaattttatagttacagtgtctatgttgcccagcctggtcttgaaccctttggctcaagtgatccacctgccttggcctcccaaagtgctgggattacagatgggagccatcgtgtctggcccattcctgcctcttaaagccctccacccaacaggcagacttgagactcaaaccgtggtcccagctctgcatcaggggtagtttggaattcagattctttcaaactggggtaaaaaccaggcccagagttcagagttcaacaacaagcttccaagatgccgcccaaaggaaaaagtggttctggaaaagcggggaaagggggtgcagcctctgggagtgacagtgctgacaagaaggctcaaggtcccaaaggtggtggcaatgcagtaaaggtcagacacattctatgggaaaaacatggcaaaatcatggaagccatggaaaagttaaagtctgggatgagattcaatgaagtggccacacaatatagtgaagataaagccaggcaagggggcgtcttgggttggatgaccagagggtccatggtgggaccatttcaagaagcagcatttgccttgcctataagtgtgatggataagcctgtgtttacagacccagcagttaagacaaaatttggatatcatattattatggttgaaggaagaaaataaaatcatatgaaagactgaaagaaaaaaaaaaaaaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]