GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:22:43, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_002989                178 bp    RNA     linear   PRI 25-MAY-2018
DEFINITION  Homo sapiens small nucleolar RNA, H/ACA box 81 (SNORA81), small
            nucleolar RNA.
ACCESSION   NR_002989
VERSION     NR_002989.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 178)
  AUTHORS   Dieci G, Preti M and Montanini B.
  TITLE     Eukaryotic snoRNAs: a paradigm for gene expression flexibility
  JOURNAL   Genomics 94 (2), 83-88 (2009)
   PUBMED   19446021
  REMARK    Review article
REFERENCE   2  (bases 1 to 178)
  AUTHORS   Lestrade L and Weber MJ.
  TITLE     snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box
            snoRNAs
  JOURNAL   Nucleic Acids Res. 34 (Database issue), D158-D162 (2006)
   PUBMED   16381836
REFERENCE   3  (bases 1 to 178)
  AUTHORS   Gu AD, Zhou H, Yu CH and Qu LH.
  TITLE     A novel experimental approach for systematic identification of box
            H/ACA snoRNAs from eukaryotes
  JOURNAL   Nucleic Acids Res. 33 (22), e194 (2005)
   PUBMED   16361266
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 178)
  AUTHORS   Kiss AM, Jady BE, Bertrand E and Kiss T.
  TITLE     Human box H/ACA pseudouridylation guide RNA machinery
  JOURNAL   Mol. Cell. Biol. 24 (13), 5797-5807 (2004)
   PUBMED   15199136
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AM055745.1.
            
            Summary: Small nucleolar RNAs (snoRNAs) are small noncoding RNAs
            involved in RNA processing. Box H/ACA snoRNAs, such as SNORA81,
            direct the conversion of uridine to pseudouridine at specific
            residues of ribosomal RNAs or small nuclear RNAs (snRNAs) (Gu et
            al., 2005).[supplied by OMIM, Mar 2008].
            
            ##Evidence-Data-START##
            Transcript is intronless :: AM055745.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-178               AM055745.1         1-178
FEATURES             Location/Qualifiers
     source          1..178
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q27.3"
     gene            1..178
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /note="small nucleolar RNA, H/ACA box 81"
                     /db_xref="GeneID:677847"
                     /db_xref="HGNC:HGNC:32667"
                     /db_xref="MIM:611334"
     ncRNA           1..178
                     /ncRNA_class="snoRNA"
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /product="small nucleolar RNA, H/ACA box 81"
                     /db_xref="GeneID:677847"
                     /db_xref="HGNC:HGNC:32667"
                     /db_xref="MIM:611334"
     exon            1..178
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372744748"
     variation       3..8
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:768764819"
     variation       3
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249058099"
     variation       5
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393385728"
     variation       6
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202149708"
     variation       7
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760474964"
     variation       9
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768431834"
     variation       10
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196100585"
     variation       10
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="t"
                     /replace="tttat"
                     /db_xref="dbSNP:1560085325"
     variation       11..14
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="ataa"
                     /replace="ataataa"
                     /db_xref="dbSNP:1359731819"
     variation       11
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776351814"
     variation       12
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344604555"
     variation       12
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1560085331"
     variation       13
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761728419"
     variation       14
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:572865136"
     variation       16
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750374080"
     variation       18
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171124595"
     variation       19..22
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1387518826"
     variation       20
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376591367"
     variation       24
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752808710"
     variation       30
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548165979"
     variation       32
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296461475"
     variation       34
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756129308"
     variation       36
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:538395242"
     variation       37
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754020514"
     variation       38
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757643215"
     variation       40
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376257420"
     variation       41..54
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="ggaccatgtcttgg"
                     /db_xref="dbSNP:1560085370"
     variation       44
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746405150"
     variation       45
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772632941"
     variation       53..54
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1465600479"
     variation       54
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1387332524"
     variation       55..59
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:753546148"
     variation       56
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428996733"
     variation       59
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941841627"
     variation       63
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779492327"
     variation       68
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746518055"
     variation       69
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73063489"
     variation       70
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776443366"
     variation       71
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427327558"
     variation       74..79
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="agagta"
                     /db_xref="dbSNP:749091759"
     variation       74..77
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1560085404"
     variation       74
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529062650"
     variation       77
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327885356"
     variation       78
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769515729"
     variation       79..85
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="acaca"
                     /replace="acacaca"
                     /db_xref="dbSNP:757125227"
     variation       79
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1156807363"
     variation       80
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374023366"
     variation       84
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1201666943"
     variation       85..92
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1232279858"
     variation       87
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568460640"
     variation       91
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263485176"
     variation       93..98
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="aa"
                     /replace="aagtaa"
                     /db_xref="dbSNP:778952832"
     variation       93
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235148789"
     variation       95
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367929995"
     variation       96
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1560085446"
     variation       97
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766352944"
     variation       102
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329059214"
     variation       104
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751386721"
     variation       105
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760776293"
     variation       106
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764112971"
     variation       107
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754110393"
     variation       110
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:896079583"
     variation       113
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757442610"
     variation       117
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330259937"
     variation       118
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020529112"
     variation       119..120
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:750389476"
     variation       119
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749096721"
     variation       120..123
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1491005629"
     variation       120
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765590984"
     variation       121
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000742171"
     variation       122
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199786736"
     variation       129
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909782373"
     variation       130..137
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="tctt"
                     /replace="tctttctt"
                     /db_xref="dbSNP:757921864"
     variation       130
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032108910"
     variation       132..137
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="t"
                     /replace="tttctt"
                     /db_xref="dbSNP:746594065"
     variation       132..134
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="t"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:779694284"
     variation       134
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750790819"
     variation       136
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="t"
                     /replace="tcaacat"
                     /db_xref="dbSNP:1468605952"
     variation       137
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1560085495"
     variation       138..139
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:768158690"
     variation       138
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200165234"
     variation       139
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202168319"
     variation       142
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370712224"
     variation       143
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550229990"
     variation       144
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964774653"
     variation       145
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267718596"
     variation       146
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373527547"
     variation       148
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215583736"
     variation       149
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754581898"
     variation       150
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975331551"
     variation       157
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780816573"
     variation       158..159
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:780942694"
     variation       160
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922972944"
     variation       161
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747874699"
     variation       162
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768810652"
     variation       163
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772682896"
     variation       164..166
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1197360908"
     variation       166
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351125602"
     variation       172..173
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1381785904"
     variation       172
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1407391127"
     variation       173
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367623414"
     variation       174
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1351719726"
     variation       175
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770593023"
     variation       176
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282811766"
     variation       177
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774296200"
     variation       178
                     /gene="SNORA81"
                     /gene_synonym="HBI-61"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907772677"
ORIGIN      
accttcttgtataagcactgtgctaaaattgcagacactaggaccatgtcttggtttttgcaataatgcttgcagagtacacacaagaagaaaagtaacagcactagattgtaaagactggggtggacctctttcttaatgtccaatgtcctttgtcttaagatttggtgcaatatct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]