GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:11:58, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_002147               2282 bp    RNA     linear   PRI 12-MAY-2018
DEFINITION  Homo sapiens myosin heavy chain 16 pseudogene (MYH16), non-coding
            RNA.
ACCESSION   NR_002147
VERSION     NR_002147.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2282)
  AUTHORS   Zhu J, Sanborn JZ, Diekhans M, Lowe CB, Pringle TH and Haussler D.
  TITLE     Comparative genomics search for losses of long-established genes on
            the human lineage
  JOURNAL   PLoS Comput. Biol. 3 (12), e247 (2007)
   PUBMED   18085818
REFERENCE   2  (bases 1 to 2282)
  AUTHORS   Perry,G.H., Verrelli,B.C. and Stone,A.C.
  TITLE     Comparative analyses reveal a complex history of molecular
            evolution for human MYH16
  JOURNAL   Mol. Biol. Evol. 22 (3), 379-382 (2005)
   PUBMED   15470226
  REMARK    Erratum:[Mol Biol Evol. 2005 Apr;22(4):1156]
REFERENCE   3  (bases 1 to 2282)
  AUTHORS   McGuigan K, Phillips PC and Postlethwait JH.
  TITLE     Evolution of sarcomeric myosin heavy chain genes: evidence from
            fish
  JOURNAL   Mol. Biol. Evol. 21 (6), 1042-1056 (2004)
   PUBMED   15014174
REFERENCE   4  (bases 1 to 2282)
  AUTHORS   Stedman HH, Kozyak BW, Nelson A, Thesier DM, Su LT, Low DW, Bridges
            CR, Shrager JB, Minugh-Purvis N and Mitchell MA.
  TITLE     Myosin gene mutation correlates with anatomical changes in the
            human lineage
  JOURNAL   Nature 428 (6981), 415-418 (2004)
   PUBMED   15042088
  REMARK    GeneRIF: first proteomic distinction between humans and chimpanzees
            that can be correlated with a traceable anatomic imprint in the
            fossil record
REFERENCE   5  (bases 1 to 2282)
  AUTHORS   Desjardins PR, Burkman JM, Shrager JB, Allmond LA and Stedman HH.
  TITLE     Evolutionary implications of three novel members of the human
            sarcomeric myosin heavy chain gene family
  JOURNAL   Mol. Biol. Evol. 19 (4), 375-393 (2002)
   PUBMED   11919279
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AK025690.1.
            On Jul 8, 2005 this sequence version replaced NR_002147.1.
            
            Summary: The MYH16 gene, encoding a sarcomeric myosin heavy chain
            expressed in nonhuman primate masticatory muscles, is inactivated
            in humans. Stedman et al. (2004) [PubMed 15042088] hypothesized
            that the decrement in masticatory muscle size caused by the
            inactivation of MYH16 removed an evolutionary constraint on
            encephalization in early man.[supplied by OMIM, Mar 2008].
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK025690.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1968540, SAMEA1968968
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            unitary pseudogene :: PMID: 15042088; inferred protein-coding
                                  ortholog GeneID: 489862
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2282
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q22.1"
     gene            1..2282
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /note="myosin heavy chain 16 pseudogene"
                     /pseudo
                     /db_xref="GeneID:84176"
                     /db_xref="HGNC:HGNC:31038"
                     /db_xref="MIM:608580"
     misc_RNA        1..2282
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /product="myosin heavy chain 16 pseudogene"
                     /pseudo
                     /db_xref="GeneID:84176"
                     /db_xref="HGNC:HGNC:31038"
                     /db_xref="MIM:608580"
     exon            1..123
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012094957"
     variation       2
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024466456"
     variation       4
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021600460"
     variation       8
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574778131"
     variation       12..25
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="aaccc"
                     /replace="aacccactcaaccc"
                     /db_xref="dbSNP:1156488422"
     variation       18
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761264805"
     variation       23
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:967811823"
     variation       24
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541707494"
     variation       26
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1030582603"
     variation       27
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412895458"
     variation       32
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335702654"
     variation       37
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918372157"
     variation       38
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771478357"
     variation       39
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772837531"
     variation       48
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335600975"
     variation       51
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764743496"
     variation       52..54
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:909566074"
     variation       55
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910711108"
     variation       62
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:942602802"
     variation       63
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750294945"
     variation       69
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760300096"
     variation       70
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205875774"
     variation       72
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933852912"
     variation       73
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260491326"
     variation       74
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:28608208"
     variation       75
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187196256"
     variation       87
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903238337"
     variation       91
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000255920"
     variation       92
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475941520"
     variation       97
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179026836"
     variation       98
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1562779117"
     variation       102
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362652817"
     variation       110
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1032947150"
     variation       116..122
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1380142461"
     variation       116
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453999709"
     variation       117
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:919587671"
     variation       123
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159896409"
     exon            124..297
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       130
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1392007022"
     variation       133
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311825424"
     variation       136
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571739314"
     variation       146
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771471146"
     variation       148
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911417935"
     variation       149
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747367279"
     variation       150
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233769177"
     variation       151
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769030728"
     variation       158
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313699270"
     variation       159..160
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1264811379"
     variation       159
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61739368"
     variation       163
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561066481"
     variation       164
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480694209"
     variation       174
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197029055"
     variation       175
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357826467"
     variation       177
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531628610"
     variation       178
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227379916"
     variation       180
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543253655"
     variation       181
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:993273084"
     variation       189
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042451208"
     variation       193
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396095370"
     variation       199
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:267601664"
     variation       201
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565030897"
     variation       202
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160448946"
     variation       204
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169004935"
     variation       206
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373006081"
     variation       214
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772698852"
     variation       223
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333459333"
     variation       224
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532668174"
     variation       237..243
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="ggag"
                     /replace="ggaggag"
                     /db_xref="dbSNP:1001205973"
     variation       248
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1326768940"
     variation       250
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266544362"
     variation       254
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190987611"
     variation       255
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212551424"
     variation       258
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294849868"
     variation       266..272
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="agaa"
                     /replace="agaagaa"
                     /db_xref="dbSNP:1307989578"
     variation       269
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970441457"
     variation       270
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002526675"
     variation       274
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1562780335"
     variation       276
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1562780338"
     variation       277
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1562780341"
     variation       278..285
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="tcaccatc"
                     /replace="tcaccatcaccatc"
                     /db_xref="dbSNP:1562780343"
     variation       278
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033589597"
     variation       281
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467602687"
     variation       282
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566156630"
     variation       287
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213987666"
     variation       288
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774183355"
     variation       291
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759322121"
     variation       292
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1185130108"
     variation       295
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989232287"
     exon            298..525
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       300
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574601516"
     variation       309
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1196530337"
     variation       312
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255981820"
     variation       314
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929835173"
     variation       326
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474957823"
     variation       328
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747484331"
     variation       329
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180715465"
     variation       333
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112278253"
     variation       335
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:951120983"
     variation       336
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984436193"
     variation       337
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345624320"
     variation       338
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907242699"
     variation       347
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311063059"
     variation       348
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239166418"
     variation       351
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781533389"
     variation       354
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369920464"
     variation       357
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1456588659"
     variation       359
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1285455766"
     variation       361
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370484498"
     variation       365
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:938799165"
     variation       369
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575328413"
     variation       372
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748573144"
     variation       373
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1554337854"
     variation       380
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354918392"
     variation       383
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219237313"
     variation       385
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894509994"
     variation       386
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61742034"
     variation       391
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769416845"
     variation       392
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934050839"
     variation       396..404
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="ggagga"
                     /replace="ggaggagga"
                     /db_xref="dbSNP:1468649870"
     variation       397
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1049533395"
     variation       398
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772785131"
     variation       400
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441376901"
     variation       401
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200236347"
     variation       411
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387868801"
     variation       413
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748795464"
     variation       414
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435296328"
     variation       417
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770366342"
     variation       420
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352310684"
     variation       424
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440793586"
     variation       425
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279835354"
     variation       432
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11769461"
     variation       433
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903452407"
     variation       439
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935980834"
     variation       440
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115927539"
     variation       443
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1451322206"
     variation       445
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1220365362"
     variation       449
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894705774"
     variation       454
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1436220757"
     variation       455
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203895517"
     variation       456
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1351206980"
     variation       459
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1351269165"
     variation       462
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238809200"
     variation       463
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775411644"
     variation       466
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191943911"
     variation       472
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045920380"
     variation       473
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907395554"
     variation       479
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478220054"
     variation       487
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174287247"
     variation       497
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760593562"
     variation       498
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025429172"
     variation       502
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331452441"
     variation       503
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1008003166"
     variation       512..516
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="ag"
                     /replace="agaag"
                     /db_xref="dbSNP:775917108"
     variation       517
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562224584"
     variation       525
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017933909"
     exon            526..630
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       533
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384073966"
     variation       536
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1321706286"
     variation       539
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1016886247"
     variation       540
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031723817"
     variation       544
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388092973"
     variation       545
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325953243"
     variation       551
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298155135"
     variation       554
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956323496"
     variation       555
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399958925"
     variation       557
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279361404"
     variation       559
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342492040"
     variation       560
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1231520758"
     variation       562
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441610868"
     variation       571
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138061825"
     variation       572
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:911896583"
     variation       585
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195993401"
     variation       599..603
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1478087078"
     variation       600
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357336478"
     variation       601
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211789271"
     variation       606
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943589549"
     variation       608..610
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1281922606"
     variation       608
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922132489"
     variation       615
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238044655"
     variation       627
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1446161642"
     exon            631..717
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       636
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277975346"
     variation       638
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773727556"
     variation       642
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17161650"
     variation       643
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287822598"
     variation       650
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464645372"
     variation       654
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989466527"
     variation       655..662
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="gagga"
                     /replace="gaggagga"
                     /db_xref="dbSNP:1562782056"
     variation       656
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772111076"
     variation       664
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210027525"
     variation       667
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913919892"
     variation       668..700
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="tgaaccacctgaccaaaaataacagcaagctga"
                     /replace="tgaaccacctgaccaaaaataacagcaagctgatgaaccacctgacca
                     aaaataacagcaagctga"
                     /db_xref="dbSNP:768740933"
     variation       669
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256275123"
     variation       671
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425021692"
     variation       672
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545865440"
     variation       673
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977041397"
     variation       677
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208014548"
     variation       680
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439528034"
     variation       686
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364701536"
     variation       694
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159638087"
     variation       698
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:922758440"
     variation       699
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362773803"
     variation       702
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433434123"
     variation       704
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150482143"
     variation       705
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768349081"
     variation       708
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316748835"
     variation       710
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1397856603"
     variation       711
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327174034"
     variation       713
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376456640"
     variation       715
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773417599"
     exon            718..863
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       723
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:61742315"
     variation       726
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337257115"
     variation       727
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1289518774"
     variation       728
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976757828"
     variation       730
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145203369"
     variation       731
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334987963"
     variation       733
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759656062"
     variation       736
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1055586270"
     variation       740
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387741875"
     variation       744
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3173583"
     variation       750
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301963057"
     variation       751
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767975365"
     variation       752
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761343393"
     variation       755
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479963402"
     variation       756
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753230145"
     variation       759
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317935778"
     variation       760
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200195123"
     variation       764
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910071426"
     variation       768
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467463084"
     variation       769
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756409126"
     variation       772
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268413217"
     variation       773
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763027915"
     variation       774
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:553121987"
     variation       775
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778000676"
     variation       776
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773518011"
     variation       784..788
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1173174913"
     variation       784
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:928933151"
     variation       790
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206596553"
     variation       794
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485901044"
     variation       798
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3173582"
     variation       803
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046063985"
     variation       807
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457540146"
     variation       808
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137946847"
     variation       810
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745338181"
     variation       813
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327653520"
     variation       814
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285780055"
     variation       815
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234349672"
     variation       818
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185320317"
     variation       829
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985595819"
     variation       830
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368141949"
     variation       836
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1398410244"
     variation       841
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1340637944"
     variation       846
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746947337"
     variation       847
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538249144"
     variation       858
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010984253"
     variation       859..863
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1319923160"
     exon            864..954
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       864
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372850223"
     variation       867
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481857942"
     variation       871
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169439407"
     variation       873
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774590387"
     variation       874
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:994453566"
     variation       885
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371585976"
     variation       886
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182701765"
     variation       887
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935852595"
     variation       888
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025763984"
     variation       893
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113139187"
     variation       894
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438002048"
     variation       898
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255304995"
     variation       903
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157833195"
     variation       912
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486138148"
     variation       915
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003005740"
     variation       918
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421467125"
     variation       926
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310974838"
     variation       927
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542936258"
     variation       933
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150794421"
     variation       934
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778246457"
     variation       935
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188409566"
     variation       936
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888487413"
     variation       938
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352679088"
     variation       943
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238887776"
     variation       949
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409622572"
     variation       954
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761079732"
     exon            955..1011
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       956
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:970652296"
     variation       958
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746147224"
     variation       959
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370790738"
     variation       962
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114396933"
     variation       963
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416360432"
     variation       972
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909946009"
     variation       973..981
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:1378162994"
     variation       974..975
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1562782600"
     variation       975
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999161269"
     variation       980..981
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1232513510"
     variation       982
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1449459729"
     variation       983
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202763962"
     variation       986
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485615519"
     variation       995
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1562782606"
     variation       996
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750121682"
     variation       998
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187194229"
     variation       1004
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344930248"
     variation       1006
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:964491011"
     exon            1012..1257
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1014
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367993359"
     variation       1015
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049274682"
     variation       1018
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277090735"
     variation       1021
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338615872"
     variation       1024
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888046964"
     variation       1025
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774502533"
     variation       1029
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550317092"
     variation       1030
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569021018"
     variation       1031
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764584128"
     variation       1032
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014044145"
     variation       1034
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:907922101"
     variation       1036
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024383605"
     variation       1040..1054
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="agctgctgaagctgc"
                     /replace="agctgctgaagctgctgaagctgc"
                     /db_xref="dbSNP:369755504"
     variation       1041
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969718428"
     variation       1054
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569068257"
     variation       1055
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539515877"
     variation       1057
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425101238"
     variation       1058
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558157460"
     variation       1069
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162260929"
     variation       1071
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212402889"
     variation       1074
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61745730"
     variation       1075
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745729"
     variation       1076
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1305552960"
     variation       1079
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359205817"
     variation       1086
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988632686"
     variation       1087
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913096568"
     variation       1091
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342392587"
     variation       1092
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555829252"
     variation       1094
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283782477"
     variation       1095
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574384531"
     variation       1097
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544828064"
     variation       1098
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193006884"
     variation       1105
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253535217"
     variation       1106
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922011829"
     variation       1107
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359867179"
     variation       1108
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211397633"
     variation       1109
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283544430"
     variation       1113
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455488973"
     variation       1114
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487924022"
     variation       1119
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217188050"
     variation       1120
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61745713"
     variation       1129
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440168542"
     variation       1131
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477404979"
     variation       1134
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049062560"
     variation       1135
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368673511"
     variation       1136
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1473543340"
     variation       1140
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165873444"
     variation       1142
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61747205"
     variation       1143
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969066154"
     variation       1144
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940969662"
     variation       1149
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036485897"
     variation       1157
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927154526"
     variation       1161
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387284346"
     variation       1163
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1317733047"
     variation       1164
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394360090"
     variation       1172
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333824343"
     variation       1174
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380206725"
     variation       1175
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1341311028"
     variation       1179
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302270618"
     variation       1180
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1248359672"
     variation       1180
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306838199"
     variation       1182..1188
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="agagaaa"
                     /db_xref="dbSNP:1352686809"
     variation       1186
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445929617"
     variation       1190
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1240840927"
     variation       1192..1196
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="aaaca"
                     /db_xref="dbSNP:1288073964"
     variation       1194
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960113639"
     variation       1198
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992834768"
     variation       1205
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1464889412"
     variation       1214
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896693576"
     variation       1215
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907974386"
     variation       1217
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176340420"
     variation       1218
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1014180031"
     variation       1219
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114121577"
     variation       1221
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1439435813"
     variation       1222
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159852123"
     variation       1224
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255068483"
     variation       1226
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758111834"
     variation       1229
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464931093"
     variation       1232
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172071645"
     variation       1234
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402950805"
     variation       1235
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179599036"
     variation       1237
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905628790"
     variation       1241
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766184861"
     variation       1242
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235070122"
     variation       1247
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329526625"
     variation       1254
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375965202"
     exon            1258..1375
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1259
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1562783748"
     variation       1264
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466279799"
     variation       1265
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299701960"
     variation       1266
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917938687"
     variation       1267
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573653136"
     variation       1269
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301853307"
     variation       1271
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779568864"
     variation       1272
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:545571229"
     variation       1273
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332845191"
     variation       1275
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346917155"
     variation       1276
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748134996"
     variation       1279
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276955107"
     variation       1284
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318163410"
     variation       1285
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206133682"
     variation       1292
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253471081"
     variation       1301
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487692846"
     variation       1311
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748673669"
     variation       1312
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268652631"
     variation       1318
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988354520"
     variation       1323
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193289554"
     variation       1324
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191606651"
     variation       1333
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1488896542"
     variation       1334
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557612958"
     variation       1338
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191278629"
     variation       1339
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172779140"
     variation       1342
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347940816"
     variation       1343
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457210425"
     variation       1344
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:981467452"
     variation       1348
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968594266"
     variation       1352
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879863872"
     variation       1354
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367381758"
     variation       1355
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772256663"
     variation       1362
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1297076100"
     variation       1365
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340544283"
     variation       1366
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114672351"
     variation       1367
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1310131286"
     variation       1373
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320356205"
     exon            1376..1503
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1378
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316201315"
     variation       1381
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1362017804"
     variation       1382
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238665948"
     variation       1386
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763452958"
     variation       1387
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383209843"
     variation       1390
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445288176"
     variation       1391
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1317651156"
     variation       1392
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754729184"
     variation       1399
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017368789"
     variation       1401
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765670153"
     variation       1402
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753037496"
     variation       1403
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1419400031"
     variation       1403
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483064692"
     variation       1408
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:180679575"
     variation       1411
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232857401"
     variation       1412
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244796979"
     variation       1414
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437584701"
     variation       1416
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216582726"
     variation       1420
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158035531"
     variation       1421
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408649364"
     variation       1422
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402308598"
     variation       1423
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766091866"
     variation       1427
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781781405"
     variation       1429
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358026386"
     variation       1431
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212775383"
     variation       1433
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466279159"
     variation       1438
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:118073704"
     variation       1439
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959299269"
     variation       1441
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1562784393"
     variation       1442
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445005005"
     variation       1449
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1308908187"
     variation       1454
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206375501"
     variation       1456
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374695446"
     variation       1457
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754391549"
     variation       1458
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565257009"
     variation       1460
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226463645"
     variation       1466
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577998669"
     variation       1473
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441065972"
     variation       1474
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538726223"
     variation       1476
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1474140527"
     variation       1492
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990823353"
     exon            1504..1700
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1507
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480687320"
     variation       1508
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200961515"
     variation       1509
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420781113"
     variation       1514
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1562784717"
     variation       1515
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776324038"
     variation       1516
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770725380"
     variation       1517
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1420717796"
     variation       1518
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530992343"
     variation       1519
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549887723"
     variation       1520
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365512724"
     variation       1522
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456920362"
     variation       1523
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116972017"
     variation       1524
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305057893"
     variation       1529
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044963988"
     variation       1530
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906343096"
     variation       1536
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748224225"
     variation       1542
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266639394"
     variation       1545
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770391861"
     variation       1546
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538629145"
     variation       1553
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951517862"
     variation       1559
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61745639"
     variation       1561
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264453921"
     variation       1564
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233387327"
     variation       1569
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490501468"
     variation       1572
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224563874"
     variation       1576
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999891692"
     variation       1578..1579
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1211245774"
     variation       1578
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753033882"
     variation       1579
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769295427"
     variation       1580
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487657428"
     variation       1581
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218015751"
     variation       1584
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367715440"
     variation       1587
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259166118"
     variation       1590
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1193540441"
     variation       1595
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771432276"
     variation       1601
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1562784766"
     variation       1604
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374421433"
     variation       1606
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773805229"
     variation       1607
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565994253"
     variation       1608
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384946424"
     variation       1609
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425899611"
     variation       1610
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165982810"
     variation       1611
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955351640"
     variation       1612
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767136457"
     variation       1614
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1319002271"
     variation       1616
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328435198"
     variation       1619
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446043715"
     variation       1625
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283408151"
     variation       1626
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359860596"
     variation       1627
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752232484"
     variation       1628
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283793344"
     variation       1637
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377169153"
     variation       1638
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008075210"
     variation       1640
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205209739"
     variation       1642
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018291836"
     variation       1645
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763219684"
     variation       1647
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440356417"
     variation       1654
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186371407"
     variation       1655
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242959804"
     variation       1656
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760220593"
     variation       1657
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186023100"
     variation       1662
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763981361"
     variation       1663
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1453596670"
     variation       1667..1668
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1159255550"
     variation       1671
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1387172723"
     variation       1679
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393699782"
     variation       1684
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413032607"
     variation       1687
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975620843"
     variation       1691
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383342722"
     variation       1693
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:922855065"
     exon            1701..1833
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1711
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936006537"
     variation       1713
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142314339"
     variation       1714
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250029463"
     variation       1719
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892060727"
     variation       1720
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480494935"
     variation       1726
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015715332"
     variation       1728
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196954908"
     variation       1734
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253272167"
     variation       1736
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569978916"
     variation       1741
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019098682"
     variation       1749
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284401809"
     variation       1756
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399431468"
     variation       1759
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900920999"
     variation       1760
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921195343"
     variation       1763
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481569700"
     variation       1765
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168752113"
     variation       1766
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781308705"
     variation       1769
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462290029"
     variation       1771
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267601665"
     variation       1773
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61743187"
     variation       1774
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:552372898"
     variation       1778
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984213518"
     variation       1781
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139073715"
     variation       1785
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934776289"
     variation       1787..1791
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:762074604"
     variation       1787
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444048240"
     variation       1789
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749813035"
     variation       1791
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346825524"
     variation       1798
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210075644"
     variation       1799
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216457657"
     variation       1802
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771628433"
     variation       1803..1805
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="agt"
                     /db_xref="dbSNP:1562785365"
     variation       1808
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307343566"
     variation       1811
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1228632906"
     variation       1813
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253379525"
     variation       1815
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214790533"
     variation       1817
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357953992"
     variation       1820..1822
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="tcg"
                     /db_xref="dbSNP:766147241"
     variation       1821
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780239348"
     variation       1822
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753987976"
     variation       1824
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:534804857"
     variation       1831..1832
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1191846293"
     variation       1832
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044596448"
     exon            1834..2050
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       1836
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345246059"
     variation       1840
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186427568"
     variation       1843
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455060020"
     variation       1850
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300707880"
     variation       1851
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459568087"
     variation       1852
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381114362"
     variation       1853
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452383208"
     variation       1854
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370642460"
     variation       1855
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771727948"
     variation       1856
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222513077"
     variation       1857
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306451140"
     variation       1858
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894075582"
     variation       1860
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1458562576"
     variation       1861
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189409594"
     variation       1867
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943371124"
     variation       1872
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330674285"
     variation       1873
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261486154"
     variation       1881
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460995504"
     variation       1886
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204067103"
     variation       1888
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567973195"
     variation       1896
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244704008"
     variation       1898
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468557045"
     variation       1905
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538500428"
     variation       1906..1907
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1380666041"
     variation       1907
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902937370"
     variation       1909
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408165082"
     variation       1911
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:998521018"
     variation       1913
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1173269382"
     variation       1913
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409013779"
     variation       1918
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1030044336"
     variation       1920
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404903027"
     variation       1922
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1326805774"
     variation       1924
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763609230"
     variation       1926..1927
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1406827226"
     variation       1926
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414310464"
     variation       1927
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771570488"
     variation       1930
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:776483348"
     variation       1933
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162279089"
     variation       1935
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753708858"
     variation       1940
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189566748"
     variation       1941
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571843874"
     variation       1942
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:538846864"
     variation       1943..1947
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="ag"
                     /replace="agaag"
                     /db_xref="dbSNP:777007149"
     variation       1947
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1562786416"
     variation       1952
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374222881"
     variation       1953
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225553866"
     variation       1954
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180947584"
     variation       1955
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572558151"
     variation       1956
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758157479"
     variation       1957
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436430256"
     variation       1958
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291117736"
     variation       1962
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001008435"
     variation       1963
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760030710"
     variation       1973
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203800277"
     variation       1974
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233399468"
     variation       1983
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:919054457"
     variation       1984..1987
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="aaga"
                     /db_xref="dbSNP:759611693"
     variation       1985
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:533553765"
     variation       1992
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012575507"
     variation       1993
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024427865"
     variation       1994
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427924140"
     variation       1995
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765461736"
     variation       1996
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971939548"
     variation       1999
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950539667"
     variation       2002..2006
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:765108427"
     variation       2002
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408563470"
     variation       2008
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:534412460"
     variation       2010
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417981847"
     variation       2013
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554909158"
     variation       2015
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444944197"
     variation       2018
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162917354"
     variation       2019
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752942518"
     variation       2022
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145047597"
     variation       2023
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777991094"
     variation       2025
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055566355"
     variation       2031
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285416167"
     variation       2036
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915489313"
     variation       2037
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571330279"
     variation       2040
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213777674"
     variation       2042
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273394288"
     variation       2043
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309203079"
     variation       2047
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042645621"
     exon            2051..2187
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       2053
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768363842"
     variation       2058
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978058971"
     variation       2061
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193429676"
     variation       2064
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243097622"
     variation       2081
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925246606"
     variation       2082
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195597585"
     variation       2086
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047466575"
     variation       2093
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451700810"
     variation       2094
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225605752"
     variation       2100
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182067429"
     variation       2103
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385164620"
     variation       2106
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1315753423"
     variation       2112
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452017099"
     variation       2116..2117
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:762974486"
     variation       2118
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165091751"
     variation       2119
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484172453"
     variation       2128
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572245678"
     variation       2133
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256952753"
     variation       2136
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760637799"
     variation       2137
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916856659"
     variation       2140
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949564449"
     variation       2143
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390638961"
     variation       2146
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776096991"
     variation       2147
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314029188"
     variation       2154..2155
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:758089309"
     variation       2154
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543177626"
     variation       2156
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114209130"
     variation       2158
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349295921"
     variation       2164
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047521330"
     variation       2171
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272821651"
     variation       2180..2182
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1412594678"
     variation       2184
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285927499"
     variation       2187
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459650201"
     exon            2188..2268
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       2189
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381696189"
     variation       2196
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751463019"
     variation       2202
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239141119"
     variation       2203
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1030999260"
     variation       2204
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179447520"
     variation       2205
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289636520"
     variation       2209
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753664663"
     variation       2210
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955377228"
     variation       2215
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262947891"
     variation       2218
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61740647"
     variation       2222
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1202769065"
     variation       2231
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1249053113"
     variation       2234
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:559525001"
     variation       2238
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753941361"
     variation       2247
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376215560"
     variation       2248
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565963279"
     variation       2252
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186263161"
     variation       2255
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746376560"
     variation       2258
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467403143"
     variation       2261
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997748707"
     variation       2265
                     /gene="MYH16"
                     /gene_synonym="MHC20; MYH16P; MYH5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286503222"
ORIGIN      
accttcattgtaacccactcaaccctggattcttttcgcagaatgggcctgaaagtcattcagcagaacgtgcgcaagttcctgcagctccgtttctggggctggtggaagctgtacaacaaggtcaagccactcctgaatgtggctcggcaagaagaggagatgaaggccaaggaggaggagctcaggaaagccatggcccaaacccaggagttggtaaacaaggtcaaggaactggaggagaagacagccacgctcagccaggagaagaatgacctcaccatccagctgcaggctgagcaagagaacctgatggatgcagaggagcgcctgacatggatgatgaagaccaagatggatctagagagccagatctcagacatgcgggagcggctggaggaggaagagggcatggcggcctcactgagtgccgccaagcgcaagttggaaggggagctgagcgacctgaagcgggacctagagggcctggaaaccacgctggccaagacagagaaggagaagcaggccctggatcacaaggtccgtaccctgacgggggacctctcactccgtgaagactccatcaccaagctccagaaggagaagagggccctagaggagctgcaccagaaaaccctggacgacctacaggctgaggaggacaaggtgaaccacctgaccaaaaataacagcaagctgagcacgcagatccatgagctggaggataactgggagcaggaaaagaaaatccgggcggaggtggaaaaggctcgtcggaaagctgagagtgacctgaagatgaccatcgacaacctcaatgagatggagcgttccaagctggatctcgaggaggtggtgaaaaagagggatttggaaataaactctgtcaactcgaaatatgaggatgagcagtctctgaattccacgctgcagcggaaactgaaggagcaccaggaccgaattgaagagctggaagaagaactagaagctgagagggccatgagagccaagatcgagcagaaccgcaagcgggaggctgagctgctgaagctgcggcgggagctggaagaggccgccctgcagagcgaggcgacggcctccacactgcgcaagaagcacgtggactccatggccgagctgacggagcatgtggagagcctgcagagggtcaagtccaagctagagaaagataaacaggtcatgaaggctgagattgatgacctcaatgccagcatggagacgatacagaagtccaagatgaacgccgaggcccacgtcagaaagctggaagacagcttatcagaagccaacgccaaggtggcagagctagagcgaaaccaagcagaaatcaatgccatcaggacccgcctccaagctgaaaatagtgaactgagcagggaatatgaagagtcccagagccggctcaatcaaatcctacggataaagacatctctgacgtcacaagtggatgattacaagaggcagctggatgaagagtcaaagtctcgcagcaccgccgtggtgagtctggccaacaccaagcacgacctggacctagtaaaggagcagctggaggaggagcagggaggcaagtcagagctgcagcgcctcgtgtccaaactcaacactgaggtcaccacctggaggaccaagtacgagaccgatgccatccagaggacagaggagctggaggagaccaagaggaagctggccgccaggcttcaggaggcagaagaagcagctgaaactgcccaggcccgggccgcctccctcgagaaaaataagcagagactccaggcagaagttgaggacctcaccatcgacttggagaaggccaatgctgcagctgctgccctggacaagaagcagaggctctttgacaagatgctggctgagtggcagcagaagtgtgaggagttgcaggtggaagtggacagctcgcagaaggagtgccgcatgtacatgacagagagcttcaagatcaagactgcctacgaggagtctctggagcatctagagtccgtgaagaaggagaataagaccctgcaggaggagataaaggatctcattgatcagctgggtgagggaggaaggagtgtgcatgaactgcagaagttgaagaaaaaattggagatggaaaaggaagaactccaggtggccctggaagaagctgagtcttccctggaggttgaagagagcaaggtgattcgaattcagttggaactggctcaggttaaagctgacatcgaccgaagaatccatgagaaaaaaaaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]