GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:10:06, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NR_001560                310 bp    RNA     linear   PRI 23-JAN-2019
DEFINITION  Homo sapiens CYCS pseudogene 52 (CYCSP52), non-coding RNA.
ACCESSION   NR_001560
VERSION     NR_001560.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 310)
  AUTHORS   Zhang Z and Gerstein M.
  TITLE     The human genome has 49 cytochrome c pseudogenes, including a relic
            of a primordial gene that still functions in mouse
  JOURNAL   Gene 312, 61-72 (2003)
   PUBMED   12909341
REFERENCE   2  (bases 1 to 310)
  AUTHORS   Evans MJ and Scarpulla RC.
  TITLE     The human somatic cytochrome c gene: two classes of processed
            pseudogenes demarcate a period of rapid molecular evolution
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 85 (24), 9625-9629 (1988)
   PUBMED   2849112
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF533163.1.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-310               AF533163.1         1-310
FEATURES             Location/Qualifiers
     source          1..310
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q23.1"
     gene            1..310
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /note="CYCS pseudogene 52"
                     /pseudo
                     /db_xref="GeneID:360155"
                     /db_xref="HGNC:HGNC:24393"
     misc_RNA        1..310
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /product="CYCS pseudogene 52"
                     /pseudo
                     /db_xref="GeneID:360155"
                     /db_xref="HGNC:HGNC:24393"
     exon            1..310
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /inference="alignment:Splign:2.1.0"
                     /pseudo
     variation       2
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427397297"
     variation       3
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463885969"
     variation       9
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370959718"
     variation       11
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467272737"
     variation       24
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480575041"
     variation       26
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557865006"
     variation       30
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001981786"
     variation       32
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251238436"
     variation       47
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054697585"
     variation       48
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396427339"
     variation       58
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226920144"
     variation       69
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324546822"
     variation       76
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285210106"
     variation       78
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020430556"
     variation       81
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773412792"
     variation       82
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390155961"
     variation       84
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:570058490"
     variation       86
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394728348"
     variation       88
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297969304"
     variation       91
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469944051"
     variation       94
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1332008629"
     variation       104
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173626163"
     variation       112
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747536541"
     variation       115
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537133387"
     variation       119
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183841942"
     variation       126..132
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="caggcca"
                     /replace="caggccaggcca"
                     /db_xref="dbSNP:953734076"
     variation       126
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249481239"
     variation       138
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:985552985"
     variation       144
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461933450"
     variation       161
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761036149"
     variation       176
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265308271"
     variation       177
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555456876"
     variation       180
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573867454"
     variation       182
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:540709646"
     variation       186
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280239268"
     variation       192
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183649324"
     variation       194
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918431409"
     variation       206
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306719361"
     variation       214
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453917926"
     variation       216
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949898891"
     variation       217
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:981523401"
     variation       224
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769419183"
     variation       227
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1159799574"
     variation       233
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1266632967"
     variation       249
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937347284"
     variation       258
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054879703"
     variation       267
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757743873"
     variation       269
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:56283707"
     variation       274
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442061640"
     variation       279
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:946291787"
     variation       288
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207030001"
     variation       293
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349154660"
     variation       296
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309219958"
     variation       301
                     /gene="CYCSP52"
                     /gene_synonym="HC6; HCP2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041832239"
ORIGIN      
acgggtgatattgagaaaggcaagaagatttgtgttcagaagtgtgcccagtgccacactgtggaaaagggaggcaagcacgagactgggcctaatctccatgtctctttgggtggaagacaggtcaggccactggattctcttacacagatgccaataagaacaaaggcattacctggggagaggataccgatggagtatttggagaatcccaagaagtacatccttggaacaaaaatgatctttgccgacattaaggcagaaaagggcagacttgatagattatctcaaaaaagctactaatggataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]