LOCUS       NM_214026               1425 bp    mRNA    linear   MAM 19-DEC-2022
DEFINITION  Sus scrofa protein kinase cAMP-dependent type I regulatory subunit
            alpha (PRKAR1A), mRNA.
ACCESSION   NM_214026
VERSION     NM_214026.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1425)
  AUTHORS   Nishimura T, Fujii W, Sugiura K and Naito K.
  TITLE     Cytoplasmic anchoring of cAMP-dependent protein kinase (PKA) by
            A-kinase anchor proteins (AKAPs) is required for meiotic arrest of
            porcine full-grown and growing oocytes
  JOURNAL   Biol Reprod 90 (3), 58 (2014)
   PUBMED   24501172
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1425)
  AUTHORS   Nishimura T, Fujii W, Kano K, Sugiura K and Naito K.
  TITLE     Analyses of the involvement of PKA regulation mechanism in meiotic
            incompetence of porcine growing oocytes
  JOURNAL   Biol Reprod 87 (3), 53 (2012)
   PUBMED   22674394
  REMARK    GeneRIF: Analyses of the involvement of PKA regulation mechanism in
            meiotic incompetence of porcine growing oocytes.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1425)
  AUTHORS   Cabral LM, Wengert M, da Ressurreicao AA, Feres-Elias PH, Almeida
            FG, Vieyra A, Caruso-Neves C and Einicker-Lamas M.
  TITLE     Ceramide is a potent activator of plasma membrane Ca2+-ATPase from
            kidney-promixal tubule cells with protein kinase A as an
            intermediate
  JOURNAL   J Biol Chem 282 (34), 24599-24606 (2007)
   PUBMED   17606608
  REMARK    GeneRIF: ceramide activates plasma membrane Ca2+-ATPase from
            kidney-promixal tubule cells with protein kinase A as an
            intermediate
REFERENCE   4  (bases 1 to 1425)
  AUTHORS   Uenishi H, Eguchi-Ogawa T, Shinkai H, Okumura N, Suzuki K, Toki D,
            Hamasima N and Awata T.
  TITLE     PEDE (Pig EST Data Explorer) has been expanded into Pig Expression
            Data Explorer, including 10 147 porcine full-length cDNA sequences
  JOURNAL   Nucleic Acids Res 35 (Database issue), D650-D653 (2007)
   PUBMED   17145712
REFERENCE   5  (bases 1 to 1425)
  AUTHORS   Uenishi H, Eguchi T, Suzuki K, Sawazaki T, Toki D, Shinkai H,
            Okumura N, Hamasima N and Awata T.
  TITLE     PEDE (Pig EST Data Explorer): construction of a database for ESTs
            derived from porcine full-length cDNA libraries
  JOURNAL   Nucleic Acids Res 32 (Database issue), D484-D488 (2004)
   PUBMED   14681463
REFERENCE   6  (bases 1 to 1425)
  AUTHORS   Mellink C, Lahbib-Mansais Y, Yerle M and Gellin J.
  TITLE     Mapping of the regulatory type I alpha and catalytic beta subunits
            of cAMP-dependent protein kinase and interleukin 1 alpha and 1 beta
            in the pig
  JOURNAL   Mamm Genome 5 (5), 298-302 (1994)
   PUBMED   8075502
REFERENCE   7  (bases 1 to 1425)
  AUTHORS   Bubis J, Vedvick TS and Taylor SS.
  TITLE     Antiparallel alignment of the two protomers of the regulatory
            subunit dimer of cAMP-dependent protein kinase I
  JOURNAL   J Biol Chem 262 (31), 14961-14966 (1987)
   PUBMED   3667618
REFERENCE   8  (bases 1 to 1425)
  AUTHORS   Nowak,I., Seipel,K., Schwarz,M., Jans,D.A. and Hemmings,B.A.
  TITLE     Isolation of a cDNA and characterization of the 5' flanking region
            of the gene encoding the type I regulatory subunit of the
            cAMP-dependent protein kinase
  JOURNAL   Eur J Biochem 167 (1), 27-33 (1987)
   PUBMED   3040400
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from X05942.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X05942.1, AK238988.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN02389762, SAMN02584787
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1425
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="12"
                     /map="12"
     gene            1..1425
                     /gene="PRKAR1A"
                     /note="protein kinase cAMP-dependent type I regulatory
                     subunit alpha"
                     /db_xref="GeneID:397091"
                     /db_xref="VGNC:VGNC:91802"
     CDS             81..1223
                     /gene="PRKAR1A"
                     /EC_number="2.7.11.1"
                     /note="cAMP-dependent protein kinase type I regulatory
                     subunit; protein kinase, cAMP-dependent, regulatory, type
                     I, alpha (tissue specific extinguisher 1)"
                     /codon_start=1
                     /product="cAMP-dependent protein kinase type I-alpha
                     regulatory subunit"
                     /protein_id="NP_999191.1"
                     /db_xref="GeneID:397091"
                     /db_xref="VGNC:VGNC:91802"
                     /translation="

MASGSTASEEERSLRECELYVQKHNIQALLKDSIVQLCTARPERPMAFLREYFERLEKEEAKQIQNLQKASARADSREDEISPPPPNPVVKGRRRRGAISAEVYTEEDAASYVRKVIPKDYKTMAALAKAIEKNVLFSHLDDNERSDIFDAMFPVSFIAGETVIQQGDEGDNFYVIDQGEMDVYVNNEWATSVGEGGSFGELALIYGTPRAATVKAKTNVKLWGNDRDSYRRILMGSTLRKRKMYEEFLSKVSILESLDKWERLTVADALEPVQFEDGQKIVVQGEPGDEFFIILEGSAAVLQRRSENEEFVEVGRLGPSDYFGEIALLMNRPRAATVVARGPLKCVKLDRPRFERVLGPCSDILKRNIQQYNSFVSLSV"

     misc_feature    81..83
                     /gene="PRKAR1A"
                     /note="N-acetylmethionine.
                     /evidence=ECO:0000250|UniProtKB:P10644; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); acetylation site"
     misc_feature    84..485
                     /gene="PRKAR1A"
                     /note="propagated from UniProtKB/Swiss-Prot (P07802.2);
                     Region: Dimerization and phosphorylation"
     misc_feature    84..86
                     /gene="PRKAR1A"
                     /note="N-acetylalanine, in cAMP-dependent protein kinase
                     type I-alpha regulatory subunit, N-terminally processed.
                     /evidence=ECO:0000250|UniProtKB:P00514; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); acetylation site"
     misc_feature    87..89
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P09456; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    117..266
                     /gene="PRKAR1A"
                     /note="dimerization/docking (D/D) domain of the Type I
                     alpha Regulatory subunit of cAMP-dependent protein kinase;
                     Region: DD_RIalpha_PKA; cd12101"
                     /db_xref="CDD:438522"
     misc_feature    order(120..122,129..134,159..164,168..173,180..185)
                     /gene="PRKAR1A"
                     /note="AKAP interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:438522"
     misc_feature    order(129..131,138..143,156..158,165..170,177..182,
                     189..194,204..206,210..221,225..230,237..242,249..251)
                     /gene="PRKAR1A"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:438522"
     misc_feature    270..368
                     /gene="PRKAR1A"
                     /note="propagated from UniProtKB/Swiss-Prot (P07802.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    306..308
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P10644; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    324..326
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P10644; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    363..377
                     /gene="PRKAR1A"
                     /note="propagated from UniProtKB/Swiss-Prot (P07802.2);
                     Region: Pseudophosphorylation motif"
     misc_feature    378..380
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9DBC7; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    486..815
                     /gene="PRKAR1A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    order(678..683,708..716)
                     /gene="PRKAR1A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(774..782,792..800)
                     /gene="PRKAR1A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
     misc_feature    840..1187
                     /gene="PRKAR1A"
                     /note="effector domain of the CAP family of transcription
                     factors; members include CAP (or cAMP receptor protein
                     (CRP)), which binds cAMP, FNR (fumarate and nitrate
                     reduction), which uses an iron-sulfur cluster to sense
                     oxygen) and CooA, a heme containing CO...; Region: CAP_ED;
                     cd00038"
                     /db_xref="CDD:237999"
     misc_feature    849..851
                     /gene="PRKAR1A"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P09456; propagated from
                     UniProtKB/Swiss-Prot (P07802.2); phosphorylation site"
     misc_feature    order(1050..1055,1080..1088)
                     /gene="PRKAR1A"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:237999"
     misc_feature    order(1146..1154,1164..1172)
                     /gene="PRKAR1A"
                     /note="flexible hinge region; other site"
                     /db_xref="CDD:237999"
ORIGIN      

gaattccgctgagggagctcagcaagccgtcacctcacaccggtaatcccgtgcccgccgccgtctgtccccagggaaccatggcgtctggcagcaccgccagtgaggaggagcgtagcctccgggaatgtgagctctacgtccagaagcacaacattcaggccctgctcaaggattctatcgtgcagttgtgcactgcgcggcccgagagacccatggcattcctcagggaatacttcgagaggttggagaaggaggaggcaaagcagatccagaatctgcagaaagcaagtgcccgggcagactcgagggaggatgaaatctctcctcctccacccaacccagtggtaaagggccgaaggcgacgaggtgctatcagtgctgaggtctatacggaggaagatgctgcatcatatgttagaaaggttataccaaaagattataagacaatggctgctttagctaaagccattgaaaagaatgtactgttttcacatcttgatgataatgagagaagtgatatttttgatgccatgtttccggtttcctttattgctggagagactgttattcagcaaggtgatgaaggggataacttctatgtgattgatcaaggagagatggatgtctatgtcaacaatgagtgggcaaccagtgttggggaaggaggaagctttggagaacttgctctgatttatggtacacctagagcagccactgtcaaggcaaagacaaatgtgaaattgtggggtaatgaccgagacagctacagaagaatccttatgggaagcacgctgagaaagcggaagatgtatgaggagtttcttagtaaagtgtctattttagaatctctggacaagtgggaacgtcttactgttgctgatgcgttggaaccagtccagtttgaagatggacagaagattgtggtgcagggagaaccaggggacgagttcttcattattttagagggttcggctgctgtactacagcgtcgttcagaaaacgaagagtttgttgaagtgggaagattggggccttctgattattttggcgaaatcgcactactgatgaatcgtcctcgcgctgccactgtggttgctcgtggcccgttgaagtgcgttaagctggaccgacctagatttgaacgtgttcttggcccgtgctcagatatcctcaaacgaaacatccagcagtacaacagttttgtgtcactgtctgtctgaaatatgcctcctgtgcctctctcttcttttctccccagtcttcactcatgcagactgctttctggtccctctttgcagcaccacgtggccactggcatcgcagcttcttgtcagtttatattaaaagttgcttttattgcaccgttttattttggagcattaactgagtgctcatacacagttaaataaatagaaagaattc

//