GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-16 04:26:07, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_212518               2368 bp    mRNA    linear   ROD 01-JUN-2024
DEFINITION  Rattus norvegicus ATP binding cassette subfamily B member 7
            (Abcb7), mRNA; nuclear gene for mitochondrial product.
ACCESSION   NM_212518 XM_217569
VERSION     NM_212518.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2368)
  AUTHORS   Kumar,V., A,A.K., Sanawar,R., Jaleel,A., Santhosh Kumar,T.R. and
            Kartha,C.C.
  TITLE     Chronic Pressure Overload Results in Deficiency of Mitochondrial
            Membrane Transporter ABCB7 Which Contributes to Iron Overload,
            Mitochondrial Dysfunction, Metabolic Shift and Worsens Cardiac
            Function
  JOURNAL   Sci Rep 9 (1), 13170 (2019)
   PUBMED   31511561
  REMARK    GeneRIF: Chronic Pressure Overload Results in Deficiency of
            Mitochondrial Membrane Transporter ABCB7 Which Contributes to Iron
            Overload, Mitochondrial Dysfunction, Metabolic Shift and Worsens
            Cardiac Function.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2368)
  AUTHORS   Maio,N. and Rouault,T.A.
  TITLE     Iron-sulfur cluster biogenesis in mammalian cells: New insights
            into the molecular mechanisms of cluster delivery
  JOURNAL   Biochim Biophys Acta 1853 (6), 1493-1512 (2015)
   PUBMED   25245479
  REMARK    Review article
REFERENCE   3  (bases 1 to 2368)
  AUTHORS   Boultwood,J., Pellagatti,A., Nikpour,M., Pushkaran,B., Fidler,C.,
            Cattan,H., Littlewood,T.J., Malcovati,L., Della Porta,M.G.,
            Jadersten,M., Killick,S., Giagounidis,A., Bowen,D.,
            Hellstrom-Lindberg,E., Cazzola,M. and Wainscoat,J.S.
  TITLE     The role of the iron transporter ABCB7 in refractory anemia with
            ring sideroblasts
  JOURNAL   PLoS One 3 (4), e1970 (2008)
   PUBMED   18398482
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2368)
  AUTHORS   Krishnamurthy,P.C., Du,G., Fukuda,Y., Sun,D., Sampath,J.,
            Mercer,K.E., Wang,J., Sosa-Pineda,B., Murti,K.G. and Schuetz,J.D.
  TITLE     Identification of a mammalian mitochondrial porphyrin transporter
  JOURNAL   Nature 443 (7111), 586-589 (2006)
   PUBMED   17006453
REFERENCE   5  (bases 1 to 2368)
  AUTHORS   Clarke,S.L., Vasanthakumar,A., Anderson,S.A., Pondarre,C.,
            Koh,C.M., Deck,K.M., Pitula,J.S., Epstein,C.J., Fleming,M.D. and
            Eisenstein,R.S.
  TITLE     Iron-responsive degradation of iron-regulatory protein 1 does not
            require the Fe-S cluster
  JOURNAL   EMBO J 25 (3), 544-553 (2006)
   PUBMED   16424901
REFERENCE   6  (bases 1 to 2368)
  AUTHORS   Da Cruz,S., Xenarios,I., Langridge,J., Vilbois,F., Parone,P.A. and
            Martinou,J.C.
  TITLE     Proteomic analysis of the mouse liver mitochondrial inner membrane
  JOURNAL   J Biol Chem 278 (42), 41566-41571 (2003)
   PUBMED   12865426
REFERENCE   7  (bases 1 to 2368)
  AUTHORS   Taketani,S., Kakimoto,K., Ueta,H., Masaki,R. and Furukawa,T.
  TITLE     Involvement of ABC7 in the biosynthesis of heme in erythroid cells:
            interaction of ABC7 with ferrochelatase
  JOURNAL   Blood 101 (8), 3274-3280 (2003)
   PUBMED   12480705
REFERENCE   8  (bases 1 to 2368)
  AUTHORS   Maguire,A., Hellier,K., Hammans,S. and May,A.
  TITLE     X-linked cerebellar ataxia and sideroblastic anaemia associated
            with a missense mutation in the ABC7 gene predicting V411L
  JOURNAL   Br J Haematol 115 (4), 910-917 (2001)
   PUBMED   11843825
REFERENCE   9  (bases 1 to 2368)
  AUTHORS   Bekri,S., Kispal,G., Lange,H., Fitzsimons,E., Tolmie,J., Lill,R.
            and Bishop,D.F.
  TITLE     Human ABC7 transporter: gene structure and mutation causing
            X-linked sideroblastic anemia with ataxia with disruption of
            cytosolic iron-sulfur protein maturation
  JOURNAL   Blood 96 (9), 3256-3264 (2000)
   PUBMED   11050011
REFERENCE   10 (bases 1 to 2368)
  AUTHORS   Allikmets,R., Raskind,W.H., Hutchinson,A., Schueck,N.D., Dean,M.
            and Koeller,D.M.
  TITLE     Mutation of a putative mitochondrial iron transporter gene (ABC7)
            in X-linked sideroblastic anemia and ataxia (XLSA/A)
  JOURNAL   Hum Mol Genet 8 (5), 743-749 (1999)
   PUBMED   10196363
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AJ621255.1.
            
            On Aug 30, 2004 this sequence version replaced XM_217569.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AJ621255.1, SRR8487226.196826.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMD00132261,
                                           SAMD00132262 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            gene product(s) localized to mito. :: inferred from homology
            RefSeq Select criteria             :: based on single
                                                  protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..2368
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="W"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq22"
     gene            1..2368
                     /gene="Abcb7"
                     /note="ATP binding cassette subfamily B member 7"
                     /db_xref="GeneID:302395"
                     /db_xref="RGD:1303086"
     exon            1..180
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     CDS             13..2271
                     /gene="Abcb7"
                     /function="transporter"
                     /note="ABC transporter 7 protein; ATP-binding cassette
                     transporter 7; ATP-binding cassette, sub-family B, member
                     7, mitochondrial; ATP-binding cassette, subfamily B
                     (MDR/TAP), member 7; ATP-binding cassette, sub-family B
                     (MDR/TAP), member 7"
                     /codon_start=1
                     /product="iron-sulfur clusters transporter ABCB7,
                     mitochondrial"
                     /protein_id="NP_997683.1"
                     /db_xref="GeneID:302395"
                     /db_xref="RGD:1303086"
                     /translation="
MALLAIHSWRWAAAAVAFEKHKHSAVLTRSLVSICGSGLRWSSYQSGASGSARLSQTTESLRNSTQQRWEKNNSRQLLDASKVLQAWPLIEKRTCWHGHAGGGLHTDPKEGLKDVDTRKIIKAMLSYVWPKDRPDLRARVAISLGFLGGAKAMNIVVPFMFKYAVDSLNQMSGNMLNLSDAPNTVATMATAVLIGYGVSRAGAAFFNEVRNAVFGKVAQNSIRRIAKNVFLHLHNLDLGFHLSRQTGALSKAIDRGTRGISFVLSALVFNLLPIVFEMTLVSSVLYYKCGAQFALVTLGTLGAYTAFTVAVTRWRTRFRIEMNKADNDAGNAAIDSLLNYETVKYFNNEKYEAQRYDGFLKTYETASLKSTSTLAMLNFGQSAIFSVGLTAIMVLASQGIVAGALTVGDLVMVNGLLFQLSLPLNFLGTVYRETRQALIDMNTLFTLLKVDTRIKDKAMASPLQITPQTATVAFDNVHFEYIEGQKVLSGVSFEVPAGKKVAIVGGSGSGKSTIVRLLFRFYEPQKGSIYLAGQNIQDVSLESLRRAVGVVPQDAVLFHNTIYYNLLYGNINASPEEVYAVAKLAGLHDAILRMPHGYDTQVGERGLKLSGGEKQRVAIARAILKDPPVILYDEATSSLDSITEETILGAMRDVVKHRTSIFIAHRLSTVVDADEIIVLSQGKVAERGTHYGLLANSSSIYSEMWHTQSTRIQNHDNLGWDAKKESLSKEEERKKLQEEIVNSVKGCGNCSC"
     transit_peptide 13..78
                     /gene="Abcb7"
                     /note="Mitochondrion. /evidence=ECO:0000255; propagated
                     from UniProtKB/Swiss-Prot (Q704E8.1)"
     mat_peptide     79..2268
                     /gene="Abcb7"
                     /product="Iron-sulfur clusters transporter ABCB7,
                     mitochondrial. /id=PRO_0000000250"
                     /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1)"
     misc_feature    385..2139
                     /gene="Abcb7"
                     /note="ABC-type transport system involved in Fe-S cluster
                     assembly, permease and ATPase components
                     [Posttranslational modification, protein turnover,
                     chaperones]; Region: ATM1; COG5265"
                     /db_xref="CDD:444078"
     misc_feature    433..495
                     /gene="Abcb7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
                     transmembrane region"
     misc_feature    568..630
                     /gene="Abcb7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
                     transmembrane region"
     misc_feature    658..660
                     /gene="Abcb7"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:O75027; propagated from
                     UniProtKB/Swiss-Prot (Q704E8.1); acetylation site"
     misc_feature    763..765
                     /gene="Abcb7"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:O75027; propagated from
                     UniProtKB/Swiss-Prot (Q704E8.1); acetylation site"
     misc_feature    790..852
                     /gene="Abcb7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
                     transmembrane region"
     misc_feature    883..945
                     /gene="Abcb7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
                     transmembrane region"
     misc_feature    1018..1020
                     /gene="Abcb7"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:16641100; propagated from
                     UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site"
     misc_feature    1030..1032
                     /gene="Abcb7"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0007744|PubMed:16641100; propagated from
                     UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site"
     misc_feature    1036..1038
                     /gene="Abcb7"
                     /note="Phosphothreonine.
                     /evidence=ECO:0007744|PubMed:16641100; propagated from
                     UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site"
     misc_feature    1060..1062
                     /gene="Abcb7"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0000250|UniProtKB:Q61102; propagated from
                     UniProtKB/Swiss-Prot (Q704E8.1); acetylation site"
     misc_feature    1159..1221
                     /gene="Abcb7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
                     transmembrane region"
     misc_feature    1240..1302
                     /gene="Abcb7"
                     /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
                     transmembrane region"
     exon            181..258
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            259..345
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            346..465
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            466..598
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            599..867
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            868..956
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            957..1044
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            1045..1219
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            1220..1377
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            1378..1541
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            1542..1671
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            1672..1843
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            1844..1947
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            1948..2055
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
     exon            2056..2368
                     /gene="Abcb7"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ccctcgctcaagatggcgctgctcgcgatacattcttggcgctgggcagccgcggcggtcgctttcgaaaagcacaagcattcggcagttctgacccggtctctagtctccatctgcggctcaggcctgcggtggagttcgtaccagagcggcgcgtcaggaagcgctcggctgtcccagactacagaatcattaagaaattctacacagcagagatgggaaaaaaacaactcaagacagttactagatgcttcaaaggttcttcaggcatggccattgatagaaaagagaacatgttggcatgggcacgcaggaggaggactccacacagacccaaaagaagggttaaaggatgttgatactagaaaaatcattaaagccatgctttcttatgtgtggcccaaagacaggcctgatctgcgagccagagttgccatttccctgggatttctgggtggtgcaaaggccatgaatattgtggttcctttcatgtttaaatatgctgtagacagcctcaaccagatgtcgggaaacatgctgaacctgagtgatgcaccaaatacagttgcaaccatggcaacagcagttctgattggctatggtgtatcaagagccggggctgcctttttcaatgaagtccgaaatgcagtatttggcaaagtagcacaaaattcaatccgaagaatagccaaaaatgtatttctccatcttcacaacttggatctgggtttccatctgagcagacagacaggagccttatctaaggctattgacagagggacaaggggcattagttttgtcctcagtgctttagtatttaatcttctccctattgtgtttgagatgacgcttgtcagtagtgttttgtattacaaatgtggggcccagtttgcattggtaaccctgggaacacttggtgcatatacagcattcacagttgcagttacacggtggagaactagatttagaatagaaatgaacaaagctgataacgatgcagggaacgctgctattgactcactgctgaattatgaaactgtgaagtattttaacaatgaaaaatatgaagcacaaagatatgatggattcttgaagacatatgagactgcttcattgaaaagtacctctactctggctatgctgaattttggccaaagtgctattttcagtgttggattaacagctatcatggtgcttgccagtcagggaattgtggcaggtgcccttactgttggagatctagtaatggtgaatggactgctttttcaactttcattaccccttaacttcttgggaactgtatatagagagacacggcaagcactcatagatatgaataccttgtttactctgctcaaggtagacacgcggattaaagacaaagcgatggcatctccccttcaaataacaccacagacagccacggtggcctttgataatgtgcattttgagtacattgaaggacagaaagtccttagcggagtatcttttgaagtccctgcaggaaagaaagtggccattgtaggaggtagtgggtcaggaaaaagcacgatagtgaggctgctgtttcgcttctatgagcctcaaaagggtagcatttaccttgctggtcaaaatattcaagatgtgagcctggaaagtcttcggcgtgcagtgggagtagtacctcaggatgctgtcctcttccataatactatctactacaacctcttatatggaaacatcaatgcgtcaccagaggaagtatatgcagtcgcaaaattggctggtcttcatgatgcaattcttcgaatgccacatggatatgacacacaagtaggagaacgaggactcaagttatcaggaggagaaaagcagagggtagcgattgcaagagccattttgaaggatcccccagttattctctatgatgaagctacttcatcattagattcgattactgaagagactattcttggtgccatgagggatgtggtgaagcacagaacttctattttcatcgcacatagattgtcaacagtggttgatgcagatgaaatcattgtcctgagccagggaaaagtagctgaacgtggtacccactatggtctgcttgctaactctagcagtatctattcagagatgtggcatacacagagcacccgcatacagaaccatgataaccttggatgggatgcaaagaaagagagtctctctaaagaggaggagagaaagaagctccaagaagagattgtcaacagcgtgaaaggctgtggaaattgctcctgctaaggaacacagacattttctcgtctttctttttgttgtcttgtttggttttgaaatatgcatttgcactgaagtaaaaccagttcacaaaaacacaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]