2025-07-16 04:26:07, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_212518 2368 bp mRNA linear ROD 01-JUN-2024 DEFINITION Rattus norvegicus ATP binding cassette subfamily B member 7 (Abcb7), mRNA; nuclear gene for mitochondrial product. ACCESSION NM_212518 XM_217569 VERSION NM_212518.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2368) AUTHORS Kumar,V., A,A.K., Sanawar,R., Jaleel,A., Santhosh Kumar,T.R. and Kartha,C.C. TITLE Chronic Pressure Overload Results in Deficiency of Mitochondrial Membrane Transporter ABCB7 Which Contributes to Iron Overload, Mitochondrial Dysfunction, Metabolic Shift and Worsens Cardiac Function JOURNAL Sci Rep 9 (1), 13170 (2019) PUBMED 31511561 REMARK GeneRIF: Chronic Pressure Overload Results in Deficiency of Mitochondrial Membrane Transporter ABCB7 Which Contributes to Iron Overload, Mitochondrial Dysfunction, Metabolic Shift and Worsens Cardiac Function. Publication Status: Online-Only REFERENCE 2 (bases 1 to 2368) AUTHORS Maio,N. and Rouault,T.A. TITLE Iron-sulfur cluster biogenesis in mammalian cells: New insights into the molecular mechanisms of cluster delivery JOURNAL Biochim Biophys Acta 1853 (6), 1493-1512 (2015) PUBMED 25245479 REMARK Review article REFERENCE 3 (bases 1 to 2368) AUTHORS Boultwood,J., Pellagatti,A., Nikpour,M., Pushkaran,B., Fidler,C., Cattan,H., Littlewood,T.J., Malcovati,L., Della Porta,M.G., Jadersten,M., Killick,S., Giagounidis,A., Bowen,D., Hellstrom-Lindberg,E., Cazzola,M. and Wainscoat,J.S. TITLE The role of the iron transporter ABCB7 in refractory anemia with ring sideroblasts JOURNAL PLoS One 3 (4), e1970 (2008) PUBMED 18398482 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 2368) AUTHORS Krishnamurthy,P.C., Du,G., Fukuda,Y., Sun,D., Sampath,J., Mercer,K.E., Wang,J., Sosa-Pineda,B., Murti,K.G. and Schuetz,J.D. TITLE Identification of a mammalian mitochondrial porphyrin transporter JOURNAL Nature 443 (7111), 586-589 (2006) PUBMED 17006453 REFERENCE 5 (bases 1 to 2368) AUTHORS Clarke,S.L., Vasanthakumar,A., Anderson,S.A., Pondarre,C., Koh,C.M., Deck,K.M., Pitula,J.S., Epstein,C.J., Fleming,M.D. and Eisenstein,R.S. TITLE Iron-responsive degradation of iron-regulatory protein 1 does not require the Fe-S cluster JOURNAL EMBO J 25 (3), 544-553 (2006) PUBMED 16424901 REFERENCE 6 (bases 1 to 2368) AUTHORS Da Cruz,S., Xenarios,I., Langridge,J., Vilbois,F., Parone,P.A. and Martinou,J.C. TITLE Proteomic analysis of the mouse liver mitochondrial inner membrane JOURNAL J Biol Chem 278 (42), 41566-41571 (2003) PUBMED 12865426 REFERENCE 7 (bases 1 to 2368) AUTHORS Taketani,S., Kakimoto,K., Ueta,H., Masaki,R. and Furukawa,T. TITLE Involvement of ABC7 in the biosynthesis of heme in erythroid cells: interaction of ABC7 with ferrochelatase JOURNAL Blood 101 (8), 3274-3280 (2003) PUBMED 12480705 REFERENCE 8 (bases 1 to 2368) AUTHORS Maguire,A., Hellier,K., Hammans,S. and May,A. TITLE X-linked cerebellar ataxia and sideroblastic anaemia associated with a missense mutation in the ABC7 gene predicting V411L JOURNAL Br J Haematol 115 (4), 910-917 (2001) PUBMED 11843825 REFERENCE 9 (bases 1 to 2368) AUTHORS Bekri,S., Kispal,G., Lange,H., Fitzsimons,E., Tolmie,J., Lill,R. and Bishop,D.F. TITLE Human ABC7 transporter: gene structure and mutation causing X-linked sideroblastic anemia with ataxia with disruption of cytosolic iron-sulfur protein maturation JOURNAL Blood 96 (9), 3256-3264 (2000) PUBMED 11050011 REFERENCE 10 (bases 1 to 2368) AUTHORS Allikmets,R., Raskind,W.H., Hutchinson,A., Schueck,N.D., Dean,M. and Koeller,D.M. TITLE Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and ataxia (XLSA/A) JOURNAL Hum Mol Genet 8 (5), 743-749 (1999) PUBMED 10196363 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AJ621255.1. On Aug 30, 2004 this sequence version replaced XM_217569.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ621255.1, SRR8487226.196826.1 [ECO:0000332] RNAseq introns :: mixed sample support SAMD00132261, SAMD00132262 [ECO:0006172] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: inferred from homology RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..2368 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="W" /db_xref="taxon:10116" /chromosome="X" /map="Xq22" gene 1..2368 /gene="Abcb7" /note="ATP binding cassette subfamily B member 7" /db_xref="GeneID:302395" /db_xref="RGD:1303086" exon 1..180 /gene="Abcb7" /inference="alignment:Splign:2.1.0" CDS 13..2271 /gene="Abcb7" /function="transporter" /note="ABC transporter 7 protein; ATP-binding cassette transporter 7; ATP-binding cassette, sub-family B, member 7, mitochondrial; ATP-binding cassette, subfamily B (MDR/TAP), member 7; ATP-binding cassette, sub-family B (MDR/TAP), member 7" /codon_start=1 /product="iron-sulfur clusters transporter ABCB7, mitochondrial" /protein_id="NP_997683.1" /db_xref="GeneID:302395" /db_xref="RGD:1303086" /translation="
MALLAIHSWRWAAAAVAFEKHKHSAVLTRSLVSICGSGLRWSSYQSGASGSARLSQTTESLRNSTQQRWEKNNSRQLLDASKVLQAWPLIEKRTCWHGHAGGGLHTDPKEGLKDVDTRKIIKAMLSYVWPKDRPDLRARVAISLGFLGGAKAMNIVVPFMFKYAVDSLNQMSGNMLNLSDAPNTVATMATAVLIGYGVSRAGAAFFNEVRNAVFGKVAQNSIRRIAKNVFLHLHNLDLGFHLSRQTGALSKAIDRGTRGISFVLSALVFNLLPIVFEMTLVSSVLYYKCGAQFALVTLGTLGAYTAFTVAVTRWRTRFRIEMNKADNDAGNAAIDSLLNYETVKYFNNEKYEAQRYDGFLKTYETASLKSTSTLAMLNFGQSAIFSVGLTAIMVLASQGIVAGALTVGDLVMVNGLLFQLSLPLNFLGTVYRETRQALIDMNTLFTLLKVDTRIKDKAMASPLQITPQTATVAFDNVHFEYIEGQKVLSGVSFEVPAGKKVAIVGGSGSGKSTIVRLLFRFYEPQKGSIYLAGQNIQDVSLESLRRAVGVVPQDAVLFHNTIYYNLLYGNINASPEEVYAVAKLAGLHDAILRMPHGYDTQVGERGLKLSGGEKQRVAIARAILKDPPVILYDEATSSLDSITEETILGAMRDVVKHRTSIFIAHRLSTVVDADEIIVLSQGKVAERGTHYGLLANSSSIYSEMWHTQSTRIQNHDNLGWDAKKESLSKEEERKKLQEEIVNSVKGCGNCSC"
transit_peptide 13..78 /gene="Abcb7" /note="Mitochondrion. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q704E8.1)" mat_peptide 79..2268 /gene="Abcb7" /product="Iron-sulfur clusters transporter ABCB7, mitochondrial. /id=PRO_0000000250" /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1)" misc_feature 385..2139 /gene="Abcb7" /note="ABC-type transport system involved in Fe-S cluster assembly, permease and ATPase components [Posttranslational modification, protein turnover, chaperones]; Region: ATM1; COG5265" /db_xref="CDD:444078" misc_feature 433..495 /gene="Abcb7" /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1); transmembrane region" misc_feature 568..630 /gene="Abcb7" /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1); transmembrane region" misc_feature 658..660 /gene="Abcb7" /note="N6-acetyllysine. /evidence=ECO:0000250|UniProtKB:O75027; propagated from UniProtKB/Swiss-Prot (Q704E8.1); acetylation site" misc_feature 763..765 /gene="Abcb7" /note="N6-acetyllysine. /evidence=ECO:0000250|UniProtKB:O75027; propagated from UniProtKB/Swiss-Prot (Q704E8.1); acetylation site" misc_feature 790..852 /gene="Abcb7" /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1); transmembrane region" misc_feature 883..945 /gene="Abcb7" /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1); transmembrane region" misc_feature 1018..1020 /gene="Abcb7" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:16641100; propagated from UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site" misc_feature 1030..1032 /gene="Abcb7" /note="Phosphotyrosine. /evidence=ECO:0007744|PubMed:16641100; propagated from UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site" misc_feature 1036..1038 /gene="Abcb7" /note="Phosphothreonine. /evidence=ECO:0007744|PubMed:16641100; propagated from UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site" misc_feature 1060..1062 /gene="Abcb7" /note="N6-acetyllysine. /evidence=ECO:0000250|UniProtKB:Q61102; propagated from UniProtKB/Swiss-Prot (Q704E8.1); acetylation site" misc_feature 1159..1221 /gene="Abcb7" /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1); transmembrane region" misc_feature 1240..1302 /gene="Abcb7" /note="propagated from UniProtKB/Swiss-Prot (Q704E8.1); transmembrane region" exon 181..258 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 259..345 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 346..465 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 466..598 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 599..867 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 868..956 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 957..1044 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 1045..1219 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 1220..1377 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 1378..1541 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 1542..1671 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 1672..1843 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 1844..1947 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 1948..2055 /gene="Abcb7" /inference="alignment:Splign:2.1.0" exon 2056..2368 /gene="Abcb7" /inference="alignment:Splign:2.1.0" ORIGIN
ccctcgctcaagatggcgctgctcgcgatacattcttggcgctgggcagccgcggcggtcgctttcgaaaagcacaagcattcggcagttctgacccggtctctagtctccatctgcggctcaggcctgcggtggagttcgtaccagagcggcgcgtcaggaagcgctcggctgtcccagactacagaatcattaagaaattctacacagcagagatgggaaaaaaacaactcaagacagttactagatgcttcaaaggttcttcaggcatggccattgatagaaaagagaacatgttggcatgggcacgcaggaggaggactccacacagacccaaaagaagggttaaaggatgttgatactagaaaaatcattaaagccatgctttcttatgtgtggcccaaagacaggcctgatctgcgagccagagttgccatttccctgggatttctgggtggtgcaaaggccatgaatattgtggttcctttcatgtttaaatatgctgtagacagcctcaaccagatgtcgggaaacatgctgaacctgagtgatgcaccaaatacagttgcaaccatggcaacagcagttctgattggctatggtgtatcaagagccggggctgcctttttcaatgaagtccgaaatgcagtatttggcaaagtagcacaaaattcaatccgaagaatagccaaaaatgtatttctccatcttcacaacttggatctgggtttccatctgagcagacagacaggagccttatctaaggctattgacagagggacaaggggcattagttttgtcctcagtgctttagtatttaatcttctccctattgtgtttgagatgacgcttgtcagtagtgttttgtattacaaatgtggggcccagtttgcattggtaaccctgggaacacttggtgcatatacagcattcacagttgcagttacacggtggagaactagatttagaatagaaatgaacaaagctgataacgatgcagggaacgctgctattgactcactgctgaattatgaaactgtgaagtattttaacaatgaaaaatatgaagcacaaagatatgatggattcttgaagacatatgagactgcttcattgaaaagtacctctactctggctatgctgaattttggccaaagtgctattttcagtgttggattaacagctatcatggtgcttgccagtcagggaattgtggcaggtgcccttactgttggagatctagtaatggtgaatggactgctttttcaactttcattaccccttaacttcttgggaactgtatatagagagacacggcaagcactcatagatatgaataccttgtttactctgctcaaggtagacacgcggattaaagacaaagcgatggcatctccccttcaaataacaccacagacagccacggtggcctttgataatgtgcattttgagtacattgaaggacagaaagtccttagcggagtatcttttgaagtccctgcaggaaagaaagtggccattgtaggaggtagtgggtcaggaaaaagcacgatagtgaggctgctgtttcgcttctatgagcctcaaaagggtagcatttaccttgctggtcaaaatattcaagatgtgagcctggaaagtcttcggcgtgcagtgggagtagtacctcaggatgctgtcctcttccataatactatctactacaacctcttatatggaaacatcaatgcgtcaccagaggaagtatatgcagtcgcaaaattggctggtcttcatgatgcaattcttcgaatgccacatggatatgacacacaagtaggagaacgaggactcaagttatcaggaggagaaaagcagagggtagcgattgcaagagccattttgaaggatcccccagttattctctatgatgaagctacttcatcattagattcgattactgaagagactattcttggtgccatgagggatgtggtgaagcacagaacttctattttcatcgcacatagattgtcaacagtggttgatgcagatgaaatcattgtcctgagccagggaaaagtagctgaacgtggtacccactatggtctgcttgctaactctagcagtatctattcagagatgtggcatacacagagcacccgcatacagaaccatgataaccttggatgggatgcaaagaaagagagtctctctaaagaggaggagagaaagaagctccaagaagagattgtcaacagcgtgaaaggctgtggaaattgctcctgctaaggaacacagacattttctcgtctttctttttgttgtcttgtttggttttgaaatatgcatttgcactgaagtaaaaccagttcacaaaaacacaaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]