ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-10-25 13:19:22, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_212518 2368 bp mRNA linear ROD 22-JUN-2025
DEFINITION Rattus norvegicus ATP binding cassette subfamily B member 7
(Abcb7), mRNA; nuclear gene for mitochondrial product.
ACCESSION NM_212518 XM_217569
VERSION NM_212518.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 2368)
AUTHORS Kumar,V., A,A.K., Sanawar,R., Jaleel,A., Santhosh Kumar,T.R. and
Kartha,C.C.
TITLE Chronic Pressure Overload Results in Deficiency of Mitochondrial
Membrane Transporter ABCB7 Which Contributes to Iron Overload,
Mitochondrial Dysfunction, Metabolic Shift and Worsens Cardiac
Function
JOURNAL Sci Rep 9 (1), 13170 (2019)
PUBMED 31511561
REMARK GeneRIF: Chronic Pressure Overload Results in Deficiency of
Mitochondrial Membrane Transporter ABCB7 Which Contributes to Iron
Overload, Mitochondrial Dysfunction, Metabolic Shift and Worsens
Cardiac Function.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 2368)
AUTHORS Maio,N. and Rouault,T.A.
TITLE Iron-sulfur cluster biogenesis in mammalian cells: New insights
into the molecular mechanisms of cluster delivery
JOURNAL Biochim Biophys Acta 1853 (6), 1493-1512 (2015)
PUBMED 25245479
REMARK Review article
REFERENCE 3 (bases 1 to 2368)
AUTHORS Boultwood,J., Pellagatti,A., Nikpour,M., Pushkaran,B., Fidler,C.,
Cattan,H., Littlewood,T.J., Malcovati,L., Della Porta,M.G.,
Jadersten,M., Killick,S., Giagounidis,A., Bowen,D.,
Hellstrom-Lindberg,E., Cazzola,M. and Wainscoat,J.S.
TITLE The role of the iron transporter ABCB7 in refractory anemia with
ring sideroblasts
JOURNAL PLoS One 3 (4), e1970 (2008)
PUBMED 18398482
REMARK Publication Status: Online-Only
REFERENCE 4 (bases 1 to 2368)
AUTHORS Krishnamurthy,P.C., Du,G., Fukuda,Y., Sun,D., Sampath,J.,
Mercer,K.E., Wang,J., Sosa-Pineda,B., Murti,K.G. and Schuetz,J.D.
TITLE Identification of a mammalian mitochondrial porphyrin transporter
JOURNAL Nature 443 (7111), 586-589 (2006)
PUBMED 17006453
REFERENCE 5 (bases 1 to 2368)
AUTHORS Clarke,S.L., Vasanthakumar,A., Anderson,S.A., Pondarre,C.,
Koh,C.M., Deck,K.M., Pitula,J.S., Epstein,C.J., Fleming,M.D. and
Eisenstein,R.S.
TITLE Iron-responsive degradation of iron-regulatory protein 1 does not
require the Fe-S cluster
JOURNAL EMBO J 25 (3), 544-553 (2006)
PUBMED 16424901
REFERENCE 6 (bases 1 to 2368)
AUTHORS Da Cruz,S., Xenarios,I., Langridge,J., Vilbois,F., Parone,P.A. and
Martinou,J.C.
TITLE Proteomic analysis of the mouse liver mitochondrial inner membrane
JOURNAL J Biol Chem 278 (42), 41566-41571 (2003)
PUBMED 12865426
REFERENCE 7 (bases 1 to 2368)
AUTHORS Taketani,S., Kakimoto,K., Ueta,H., Masaki,R. and Furukawa,T.
TITLE Involvement of ABC7 in the biosynthesis of heme in erythroid cells:
interaction of ABC7 with ferrochelatase
JOURNAL Blood 101 (8), 3274-3280 (2003)
PUBMED 12480705
REFERENCE 8 (bases 1 to 2368)
AUTHORS Maguire,A., Hellier,K., Hammans,S. and May,A.
TITLE X-linked cerebellar ataxia and sideroblastic anaemia associated
with a missense mutation in the ABC7 gene predicting V411L
JOURNAL Br J Haematol 115 (4), 910-917 (2001)
PUBMED 11843825
REFERENCE 9 (bases 1 to 2368)
AUTHORS Bekri,S., Kispal,G., Lange,H., Fitzsimons,E., Tolmie,J., Lill,R.
and Bishop,D.F.
TITLE Human ABC7 transporter: gene structure and mutation causing
X-linked sideroblastic anemia with ataxia with disruption of
cytosolic iron-sulfur protein maturation
JOURNAL Blood 96 (9), 3256-3264 (2000)
PUBMED 11050011
REFERENCE 10 (bases 1 to 2368)
AUTHORS Allikmets,R., Raskind,W.H., Hutchinson,A., Schueck,N.D., Dean,M.
and Koeller,D.M.
TITLE Mutation of a putative mitochondrial iron transporter gene (ABC7)
in X-linked sideroblastic anemia and ataxia (XLSA/A)
JOURNAL Hum Mol Genet 8 (5), 743-749 (1999)
PUBMED 10196363
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AJ621255.1.
On Aug 30, 2004 this sequence version replaced XM_217569.2.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AJ621255.1, SRR8487226.196826.1
[ECO:0000332]
RNAseq introns :: mixed sample support SAMD00132261,
SAMD00132262 [ECO:0006172]
##Evidence-Data-END##
##RefSeq-Attributes-START##
gene product(s) localized to mito. :: inferred from homology
RefSeq Select criteria :: based on single
protein-coding transcript
##RefSeq-Attributes-END##
FEATURES Location/Qualifiers
source 1..2368
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="W"
/db_xref="taxon:10116"
/chromosome="X"
/map="Xq22"
gene 1..2368
/gene="Abcb7"
/note="ATP binding cassette subfamily B member 7"
/db_xref="GeneID:302395"
/db_xref="RGD:1303086"
exon 1..180
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
CDS 13..2271
/gene="Abcb7"
/function="transporter"
/note="ABC transporter 7 protein; ATP-binding cassette
transporter 7; ATP-binding cassette, sub-family B, member
7, mitochondrial; ATP-binding cassette, subfamily B
(MDR/TAP), member 7; ATP-binding cassette, sub-family B
(MDR/TAP), member 7"
/codon_start=1
/product="iron-sulfur clusters transporter ABCB7,
mitochondrial"
/protein_id="NP_997683.1"
/db_xref="GeneID:302395"
/db_xref="RGD:1303086"
/translation="
MALLAIHSWRWAAAAVAFEKHKHSAVLTRSLVSICGSGLRWSSYQSGASGSARLSQTTESLRNSTQQRWEKNNSRQLLDASKVLQAWPLIEKRTCWHGHAGGGLHTDPKEGLKDVDTRKIIKAMLSYVWPKDRPDLRARVAISLGFLGGAKAMNIVVPFMFKYAVDSLNQMSGNMLNLSDAPNTVATMATAVLIGYGVSRAGAAFFNEVRNAVFGKVAQNSIRRIAKNVFLHLHNLDLGFHLSRQTGALSKAIDRGTRGISFVLSALVFNLLPIVFEMTLVSSVLYYKCGAQFALVTLGTLGAYTAFTVAVTRWRTRFRIEMNKADNDAGNAAIDSLLNYETVKYFNNEKYEAQRYDGFLKTYETASLKSTSTLAMLNFGQSAIFSVGLTAIMVLASQGIVAGALTVGDLVMVNGLLFQLSLPLNFLGTVYRETRQALIDMNTLFTLLKVDTRIKDKAMASPLQITPQTATVAFDNVHFEYIEGQKVLSGVSFEVPAGKKVAIVGGSGSGKSTIVRLLFRFYEPQKGSIYLAGQNIQDVSLESLRRAVGVVPQDAVLFHNTIYYNLLYGNINASPEEVYAVAKLAGLHDAILRMPHGYDTQVGERGLKLSGGEKQRVAIARAILKDPPVILYDEATSSLDSITEETILGAMRDVVKHRTSIFIAHRLSTVVDADEIIVLSQGKVAERGTHYGLLANSSSIYSEMWHTQSTRIQNHDNLGWDAKKESLSKEEERKKLQEEIVNSVKGCGNCSC"
transit_peptide 13..78
/gene="Abcb7"
/note="Mitochondrion. /evidence=ECO:0000255; propagated
from UniProtKB/Swiss-Prot (Q704E8.1)"
mat_peptide 79..2268
/gene="Abcb7"
/product="Iron-sulfur clusters transporter ABCB7,
mitochondrial. /id=PRO_0000000250"
/note="propagated from UniProtKB/Swiss-Prot (Q704E8.1)"
misc_feature 385..2139
/gene="Abcb7"
/note="ABC-type transport system involved in Fe-S cluster
assembly, permease and ATPase components
[Posttranslational modification, protein turnover,
chaperones]; Region: ATM1; COG5265"
/db_xref="CDD:444078"
misc_feature 433..495
/gene="Abcb7"
/note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
transmembrane region"
misc_feature 568..630
/gene="Abcb7"
/note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
transmembrane region"
misc_feature 658..660
/gene="Abcb7"
/note="N6-acetyllysine.
/evidence=ECO:0000250|UniProtKB:O75027; propagated from
UniProtKB/Swiss-Prot (Q704E8.1); acetylation site"
misc_feature 763..765
/gene="Abcb7"
/note="N6-acetyllysine.
/evidence=ECO:0000250|UniProtKB:O75027; propagated from
UniProtKB/Swiss-Prot (Q704E8.1); acetylation site"
misc_feature 790..852
/gene="Abcb7"
/note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
transmembrane region"
misc_feature 883..945
/gene="Abcb7"
/note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
transmembrane region"
misc_feature 1018..1020
/gene="Abcb7"
/note="Phosphoserine.
/evidence=ECO:0007744|PubMed:16641100; propagated from
UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site"
misc_feature 1030..1032
/gene="Abcb7"
/note="Phosphotyrosine.
/evidence=ECO:0007744|PubMed:16641100; propagated from
UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site"
misc_feature 1036..1038
/gene="Abcb7"
/note="Phosphothreonine.
/evidence=ECO:0007744|PubMed:16641100; propagated from
UniProtKB/Swiss-Prot (Q704E8.1); phosphorylation site"
misc_feature 1060..1062
/gene="Abcb7"
/note="N6-acetyllysine.
/evidence=ECO:0000250|UniProtKB:Q61102; propagated from
UniProtKB/Swiss-Prot (Q704E8.1); acetylation site"
misc_feature 1159..1221
/gene="Abcb7"
/note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
transmembrane region"
misc_feature 1240..1302
/gene="Abcb7"
/note="propagated from UniProtKB/Swiss-Prot (Q704E8.1);
transmembrane region"
exon 181..258
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 259..345
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 346..465
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 466..598
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 599..867
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 868..956
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 957..1044
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 1045..1219
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 1220..1377
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 1378..1541
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 1542..1671
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 1672..1843
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 1844..1947
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 1948..2055
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
exon 2056..2368
/gene="Abcb7"
/inference="alignment:Splign:2.1.0"
ORIGIN
ccctcgctcaagatggcgctgctcgcgatacattcttggcgctgggcagccgcggcggtcgctttcgaaaagcacaagcattcggcagttctgacccggtctctagtctccatctgcggctcaggcctgcggtggagttcgtaccagagcggcgcgtcaggaagcgctcggctgtcccagactacagaatcattaagaaattctacacagcagagatgggaaaaaaacaactcaagacagttactagatgcttcaaaggttcttcaggcatggccattgatagaaaagagaacatgttggcatgggcacgcaggaggaggactccacacagacccaaaagaagggttaaaggatgttgatactagaaaaatcattaaagccatgctttcttatgtgtggcccaaagacaggcctgatctgcgagccagagttgccatttccctgggatttctgggtggtgcaaaggccatgaatattgtggttcctttcatgtttaaatatgctgtagacagcctcaaccagatgtcgggaaacatgctgaacctgagtgatgcaccaaatacagttgcaaccatggcaacagcagttctgattggctatggtgtatcaagagccggggctgcctttttcaatgaagtccgaaatgcagtatttggcaaagtagcacaaaattcaatccgaagaatagccaaaaatgtatttctccatcttcacaacttggatctgggtttccatctgagcagacagacaggagccttatctaaggctattgacagagggacaaggggcattagttttgtcctcagtgctttagtatttaatcttctccctattgtgtttgagatgacgcttgtcagtagtgttttgtattacaaatgtggggcccagtttgcattggtaaccctgggaacacttggtgcatatacagcattcacagttgcagttacacggtggagaactagatttagaatagaaatgaacaaagctgataacgatgcagggaacgctgctattgactcactgctgaattatgaaactgtgaagtattttaacaatgaaaaatatgaagcacaaagatatgatggattcttgaagacatatgagactgcttcattgaaaagtacctctactctggctatgctgaattttggccaaagtgctattttcagtgttggattaacagctatcatggtgcttgccagtcagggaattgtggcaggtgcccttactgttggagatctagtaatggtgaatggactgctttttcaactttcattaccccttaacttcttgggaactgtatatagagagacacggcaagcactcatagatatgaataccttgtttactctgctcaaggtagacacgcggattaaagacaaagcgatggcatctccccttcaaataacaccacagacagccacggtggcctttgataatgtgcattttgagtacattgaaggacagaaagtccttagcggagtatcttttgaagtccctgcaggaaagaaagtggccattgtaggaggtagtgggtcaggaaaaagcacgatagtgaggctgctgtttcgcttctatgagcctcaaaagggtagcatttaccttgctggtcaaaatattcaagatgtgagcctggaaagtcttcggcgtgcagtgggagtagtacctcaggatgctgtcctcttccataatactatctactacaacctcttatatggaaacatcaatgcgtcaccagaggaagtatatgcagtcgcaaaattggctggtcttcatgatgcaattcttcgaatgccacatggatatgacacacaagtaggagaacgaggactcaagttatcaggaggagaaaagcagagggtagcgattgcaagagccattttgaaggatcccccagttattctctatgatgaagctacttcatcattagattcgattactgaagagactattcttggtgccatgagggatgtggtgaagcacagaacttctattttcatcgcacatagattgtcaacagtggttgatgcagatgaaatcattgtcctgagccagggaaaagtagctgaacgtggtacccactatggtctgcttgctaactctagcagtatctattcagagatgtggcatacacagagcacccgcatacagaaccatgataaccttggatgggatgcaaagaaagagagtctctctaaagaggaggagagaaagaagctccaagaagagattgtcaacagcgtgaaaggctgtggaaattgctcctgctaaggaacacagacattttctcgtctttctttttgttgtcttgtttggttttgaaatatgcatttgcactgaagtaaaaccagttcacaaaaacacaaat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]